Incidental Mutation 'R6880:Sulf1'
ID536586
Institutional Source Beutler Lab
Gene Symbol Sulf1
Ensembl Gene ENSMUSG00000016918
Gene Namesulfatase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.537) question?
Stock #R6880 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location12692277-12861192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12842755 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 738 (C738R)
Ref Sequence ENSEMBL: ENSMUSP00000136014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088585] [ENSMUST00000177608] [ENSMUST00000180062] [ENSMUST00000185780] [ENSMUST00000186051]
Predicted Effect probably damaging
Transcript: ENSMUST00000088585
AA Change: C738R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085949
Gene: ENSMUSG00000016918
AA Change: C738R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177608
AA Change: C738R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137523
Gene: ENSMUSG00000016918
AA Change: C738R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 534 678 9.7e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180062
AA Change: C738R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136014
Gene: ENSMUSG00000016918
AA Change: C738R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185780
Predicted Effect probably damaging
Transcript: ENSMUST00000186051
AA Change: C738R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141153
Gene: ENSMUSG00000016918
AA Change: C738R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.4e-56 PFAM
Pfam:Phosphodiest 61 323 9.6e-8 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 1.1e-48 PFAM
low complexity region 717 737 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null allele display a slight increase in mortality early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,069,705 probably null Het
Aff3 T C 1: 38,535,162 H206R probably damaging Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Alg5 A G 3: 54,738,843 E43G probably damaging Het
Ankrd36 T C 11: 5,628,748 L4P probably damaging Het
Ano1 T C 7: 144,644,742 Y345C probably benign Het
Atf7ip A G 6: 136,561,040 I432V probably damaging Het
B230307C23Rik T C 16: 97,997,427 probably benign Het
Baz2b T A 2: 59,912,939 N1563Y probably damaging Het
Bhlha15 A T 5: 144,191,633 T188S probably damaging Het
Cbr3 T C 16: 93,690,538 V203A probably benign Het
Cpsf1 T C 15: 76,602,539 T266A probably benign Het
Dnah7c T C 1: 46,527,671 Y681H probably damaging Het
Dock2 C T 11: 34,688,452 probably null Het
Dsc1 T A 18: 20,088,372 D682V probably damaging Het
Fkbp15 A T 4: 62,336,495 I256N possibly damaging Het
Foxd1 A C 13: 98,354,717 D33A unknown Het
Gid4 T A 11: 60,436,435 F149I probably damaging Het
Hmcn2 G T 2: 31,343,056 V206L probably damaging Het
Ighg2b T C 12: 113,307,106 I135V Het
Ighv1-24 T C 12: 114,773,043 Y79C possibly damaging Het
Impg1 T A 9: 80,404,800 D167V probably damaging Het
Jakmip1 T C 5: 37,105,623 S372P possibly damaging Het
Kcnb1 T C 2: 167,105,807 T374A probably damaging Het
Lrrn4 A G 2: 132,872,112 S305P probably damaging Het
Ltbp1 C T 17: 75,321,049 T1179I possibly damaging Het
Mab21l2 A G 3: 86,547,156 I179T possibly damaging Het
Myo5b A T 18: 74,722,430 H1230L probably benign Het
Myocos T C 1: 162,657,033 probably null Het
Nipa2 T C 7: 55,933,251 T249A probably damaging Het
Oas1a C A 5: 120,901,940 R196L probably damaging Het
Olfr228 A G 2: 86,483,725 F6L probably benign Het
Olfr235 A G 19: 12,268,610 I127V probably benign Het
Olfr700 A T 7: 106,805,812 S217T probably damaging Het
Phxr2 G A 10: 99,126,084 probably benign Het
Pigq A G 17: 25,934,828 L85P probably damaging Het
Pla2g4a T A 1: 149,851,451 D518V possibly damaging Het
Pm20d1 A G 1: 131,804,101 K294E probably benign Het
Polr3d C A 14: 70,440,015 R307L probably benign Het
Pou5f2 T C 13: 78,025,494 L185P possibly damaging Het
Prex2 A T 1: 11,132,384 N506Y probably damaging Het
Proser1 T A 3: 53,477,839 S381T probably benign Het
Prpf4b T C 13: 34,894,453 V682A possibly damaging Het
Prr14l A T 5: 32,830,867 L428Q probably benign Het
Prss23 A G 7: 89,510,825 V12A probably benign Het
Qk T C 17: 10,215,447 D321G probably benign Het
Rab11fip5 A G 6: 85,348,845 L193P probably damaging Het
Retreg1 T G 15: 25,971,739 L245R probably damaging Het
Rfc1 T C 5: 65,277,386 N679S probably benign Het
Rpl4 C T 9: 64,177,053 A220V probably damaging Het
Rxra G A 2: 27,748,656 E224K possibly damaging Het
Slc26a7 A G 4: 14,516,159 C557R possibly damaging Het
Sncaip A G 18: 52,869,064 K219R probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sphkap A G 1: 83,257,257 V1616A probably damaging Het
Suz12 T A 11: 80,002,172 C38* probably null Het
Ttn T C 2: 76,720,498 T23190A probably damaging Het
Twnk A G 19: 45,007,416 D96G probably benign Het
Vcan T A 13: 89,712,381 N289I probably damaging Het
Vmn2r120 A T 17: 57,509,187 S723T probably damaging Het
Vmn2r97 A T 17: 18,914,508 I63F probably benign Het
Washc5 T C 15: 59,350,172 N125S probably benign Het
Zfp865 A G 7: 5,030,549 Y511C probably damaging Het
Other mutations in Sulf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Sulf1 APN 1 12820463 missense probably damaging 0.99
IGL00788:Sulf1 APN 1 12848449 missense probably damaging 0.99
IGL00845:Sulf1 APN 1 12796967 missense probably damaging 1.00
IGL01606:Sulf1 APN 1 12836204 missense possibly damaging 0.87
IGL01963:Sulf1 APN 1 12818507 missense probably damaging 1.00
IGL01968:Sulf1 APN 1 12818451 missense probably damaging 1.00
IGL02072:Sulf1 APN 1 12848208 missense probably damaging 1.00
IGL02424:Sulf1 APN 1 12796840 missense probably benign 0.28
IGL02519:Sulf1 APN 1 12838363 nonsense probably null
IGL02601:Sulf1 APN 1 12786645 missense probably damaging 1.00
IGL03066:Sulf1 APN 1 12807944 missense probably damaging 0.99
IGL03200:Sulf1 APN 1 12786617 nonsense probably null
PIT4480001:Sulf1 UTSW 1 12859413 missense probably benign 0.01
PIT4519001:Sulf1 UTSW 1 12848171 missense probably damaging 1.00
R0083:Sulf1 UTSW 1 12817417 missense probably damaging 0.99
R0467:Sulf1 UTSW 1 12796920 missense probably damaging 1.00
R0554:Sulf1 UTSW 1 12805194 missense probably damaging 1.00
R0626:Sulf1 UTSW 1 12817492 splice site probably null
R1083:Sulf1 UTSW 1 12836164 frame shift probably null
R1084:Sulf1 UTSW 1 12836164 frame shift probably null
R1498:Sulf1 UTSW 1 12848350 missense probably damaging 1.00
R1523:Sulf1 UTSW 1 12817350 nonsense probably null
R1854:Sulf1 UTSW 1 12838437 missense probably benign 0.06
R1942:Sulf1 UTSW 1 12848173 missense probably damaging 1.00
R1946:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R1998:Sulf1 UTSW 1 12858834 nonsense probably null
R2034:Sulf1 UTSW 1 12820421 missense probably damaging 1.00
R2068:Sulf1 UTSW 1 12840403 missense probably damaging 1.00
R2113:Sulf1 UTSW 1 12848174 missense probably damaging 0.99
R2277:Sulf1 UTSW 1 12796794 missense probably benign 0.41
R3827:Sulf1 UTSW 1 12817432 missense probably benign
R3874:Sulf1 UTSW 1 12817412 missense probably damaging 1.00
R4488:Sulf1 UTSW 1 12786515 start gained probably benign
R4619:Sulf1 UTSW 1 12786652 missense probably damaging 1.00
R4743:Sulf1 UTSW 1 12836293 missense probably benign 0.04
R4836:Sulf1 UTSW 1 12842686 missense probably benign 0.02
R4918:Sulf1 UTSW 1 12818496 missense probably damaging 1.00
R4958:Sulf1 UTSW 1 12796910 missense probably benign 0.08
R5216:Sulf1 UTSW 1 12796874 missense probably benign 0.28
R5225:Sulf1 UTSW 1 12841478 missense probably benign
R5427:Sulf1 UTSW 1 12796912 missense possibly damaging 0.84
R5450:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R5909:Sulf1 UTSW 1 12858815 missense possibly damaging 0.94
R5912:Sulf1 UTSW 1 12786752 unclassified probably benign
R5966:Sulf1 UTSW 1 12859412 missense probably benign 0.06
R6339:Sulf1 UTSW 1 12838440 missense probably damaging 1.00
R6841:Sulf1 UTSW 1 12838434 missense probably damaging 1.00
R7110:Sulf1 UTSW 1 12838601 missense probably damaging 1.00
R7255:Sulf1 UTSW 1 12859008 missense probably benign 0.00
R7275:Sulf1 UTSW 1 12850965 splice site probably null
R7386:Sulf1 UTSW 1 12838361 missense probably benign 0.07
R7611:Sulf1 UTSW 1 12836243 missense probably benign
R7732:Sulf1 UTSW 1 12842789 missense probably benign 0.11
R7796:Sulf1 UTSW 1 12858820 missense probably benign 0.27
R7898:Sulf1 UTSW 1 12805294 missense probably damaging 1.00
R7984:Sulf1 UTSW 1 12859273 missense probably benign 0.00
R8003:Sulf1 UTSW 1 12838601 missense probably damaging 1.00
R8684:Sulf1 UTSW 1 12796780 missense probably benign 0.06
R8714:Sulf1 UTSW 1 12807917 missense probably benign 0.07
R8723:Sulf1 UTSW 1 12786687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTACTGGCTATATTTGAAGCC -3'
(R):5'- CCATTTGGAACCCCTGGATTG -3'

Sequencing Primer
(F):5'- TTGAAGCCCTCTGTGAAAGC -3'
(R):5'- GAACCCCTGGATTGACTGGTTTAC -3'
Posted On2018-10-18