Mutagenetix > Incidental Mutation

Incidental Mutation 'R6880:Baz2b'

536596

Institutional Source

Beutler Lab

Gene Symbol

Baz2b

Ensembl Gene

ENSMUSG00000026987

Gene Name

bromodomain adjacent to zinc finger domain, 2B

Synonyms

D2Ertd794e, 5830435C13Rik

MMRRC Submission

044976-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.307) question?

Stock #

R6880 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59899363-60209839 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 59912939 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 1563 (N1563Y)

Ref Sequence

ENSEMBL: ENSMUSP00000108169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]

AlphaFold

A2AUY4

Predicted Effect

probably damaging
Transcript: ENSMUST00000090925
AA Change: N1563Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: N1563Y

Domain	Start	End	E-Value	Type
low complexity region	7	46	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
low complexity region	147	162	N/A	INTRINSIC
low complexity region	193	244	N/A	INTRINSIC
low complexity region	291	308	N/A	INTRINSIC
low complexity region	366	385	N/A	INTRINSIC
low complexity region	528	540	N/A	INTRINSIC
low complexity region	554	614	N/A	INTRINSIC
low complexity region	628	637	N/A	INTRINSIC
low complexity region	671	685	N/A	INTRINSIC
Pfam:MBD	690	742	1e-12	PFAM
low complexity region	759	774	N/A	INTRINSIC
coiled coil region	814	975	N/A	INTRINSIC
DDT	1004	1069	1.19e-20	SMART
low complexity region	1199	1212	N/A	INTRINSIC
low complexity region	1213	1247	N/A	INTRINSIC
coiled coil region	1251	1286	N/A	INTRINSIC
low complexity region	1320	1337	N/A	INTRINSIC
low complexity region	1503	1524	N/A	INTRINSIC
low complexity region	1569	1582	N/A	INTRINSIC
low complexity region	1585	1605	N/A	INTRINSIC
Blast:BROMO	1802	1843	7e-18	BLAST
PHD	1888	1934	1.71e-12	SMART
low complexity region	1942	1964	N/A	INTRINSIC
low complexity region	1968	1980	N/A	INTRINSIC
BROMO	2013	2121	3.85e-41	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112550
AA Change: N1563Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: N1563Y

Domain	Start	End	E-Value	Type
low complexity region	7	46	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
low complexity region	147	162	N/A	INTRINSIC
low complexity region	193	244	N/A	INTRINSIC
low complexity region	291	308	N/A	INTRINSIC
low complexity region	366	385	N/A	INTRINSIC
low complexity region	528	540	N/A	INTRINSIC
low complexity region	554	614	N/A	INTRINSIC
low complexity region	628	637	N/A	INTRINSIC
low complexity region	671	685	N/A	INTRINSIC
Pfam:MBD	690	741	3.4e-13	PFAM
low complexity region	759	774	N/A	INTRINSIC
coiled coil region	814	975	N/A	INTRINSIC
DDT	1004	1069	1.19e-20	SMART
low complexity region	1199	1212	N/A	INTRINSIC
low complexity region	1213	1247	N/A	INTRINSIC
coiled coil region	1251	1286	N/A	INTRINSIC
low complexity region	1320	1337	N/A	INTRINSIC
low complexity region	1503	1524	N/A	INTRINSIC
low complexity region	1569	1582	N/A	INTRINSIC
low complexity region	1585	1605	N/A	INTRINSIC
Pfam:WHIM3	1638	1676	5.1e-14	PFAM
Blast:BROMO	1802	1843	7e-18	BLAST
PHD	1888	1934	1.71e-12	SMART
low complexity region	1942	1964	N/A	INTRINSIC
low complexity region	1968	1980	N/A	INTRINSIC
BROMO	2013	2121	3.85e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130637

SMART Domains

Protein: ENSMUSP00000119690
Gene: ENSMUSG00000026987

Domain	Start	End	E-Value	Type
Pfam:WHIM3	2	37	1.8e-13	PFAM
low complexity region	162	173	N/A	INTRINSIC
PHD	214	253	2.05e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

97% (62/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	T	A	3: 36,069,705		probably null	Het
Aff3	T	C	1: 38,535,162	H206R	probably damaging	Het
Aff3	T	C	1: 38,627,128	D5G	possibly damaging	Het
Alg5	A	G	3: 54,738,843	E43G	probably damaging	Het
Ankrd36	T	C	11: 5,628,748	L4P	probably damaging	Het
Ano1	T	C	7: 144,644,742	Y345C	probably benign	Het
Atf7ip	A	G	6: 136,561,040	I432V	probably damaging	Het
B230307C23Rik	T	C	16: 97,997,427		probably benign	Het
Bhlha15	A	T	5: 144,191,633	T188S	probably damaging	Het
Cbr3	T	C	16: 93,690,538	V203A	probably benign	Het
Cpsf1	T	C	15: 76,602,539	T266A	probably benign	Het
Dnah7c	T	C	1: 46,527,671	Y681H	probably damaging	Het
Dock2	C	T	11: 34,688,452		probably null	Het
Dsc1	T	A	18: 20,088,372	D682V	probably damaging	Het
Fkbp15	A	T	4: 62,336,495	I256N	possibly damaging	Het
Foxd1	A	C	13: 98,354,717	D33A	unknown	Het
Gid4	T	A	11: 60,436,435	F149I	probably damaging	Het
Hmcn2	G	T	2: 31,343,056	V206L	probably damaging	Het
Ighg2b	T	C	12: 113,307,106	I135V		Het
Ighv1-24	T	C	12: 114,773,043	Y79C	possibly damaging	Het
Impg1	T	A	9: 80,404,800	D167V	probably damaging	Het
Jakmip1	T	C	5: 37,105,623	S372P	possibly damaging	Het
Kcnb1	T	C	2: 167,105,807	T374A	probably damaging	Het
Lrrn4	A	G	2: 132,872,112	S305P	probably damaging	Het
Ltbp1	C	T	17: 75,321,049	T1179I	possibly damaging	Het
Mab21l2	A	G	3: 86,547,156	I179T	possibly damaging	Het
Myo5b	A	T	18: 74,722,430	H1230L	probably benign	Het
Myocos	T	C	1: 162,657,033		probably null	Het
Nipa2	T	C	7: 55,933,251	T249A	probably damaging	Het
Oas1a	C	A	5: 120,901,940	R196L	probably damaging	Het
Olfr228	A	G	2: 86,483,725	F6L	probably benign	Het
Olfr235	A	G	19: 12,268,610	I127V	probably benign	Het
Olfr700	A	T	7: 106,805,812	S217T	probably damaging	Het
Phxr2	G	A	10: 99,126,084		probably benign	Het
Pigq	A	G	17: 25,934,828	L85P	probably damaging	Het
Pla2g4a	T	A	1: 149,851,451	D518V	possibly damaging	Het
Pm20d1	A	G	1: 131,804,101	K294E	probably benign	Het
Polr3d	C	A	14: 70,440,015	R307L	probably benign	Het
Pou5f2	T	C	13: 78,025,494	L185P	possibly damaging	Het
Prex2	A	T	1: 11,132,384	N506Y	probably damaging	Het
Proser1	T	A	3: 53,477,839	S381T	probably benign	Het
Prpf4b	T	C	13: 34,894,453	V682A	possibly damaging	Het
Prr14l	A	T	5: 32,830,867	L428Q	probably benign	Het
Prss23	A	G	7: 89,510,825	V12A	probably benign	Het
Qk	T	C	17: 10,215,447	D321G	probably benign	Het
Rab11fip5	A	G	6: 85,348,845	L193P	probably damaging	Het
Retreg1	T	G	15: 25,971,739	L245R	probably damaging	Het
Rfc1	T	C	5: 65,277,386	N679S	probably benign	Het
Rpl4	C	T	9: 64,177,053	A220V	probably damaging	Het
Rxra	G	A	2: 27,748,656	E224K	possibly damaging	Het
Slc26a7	A	G	4: 14,516,159	C557R	possibly damaging	Het
Sncaip	A	G	18: 52,869,064	K219R	probably damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Sphkap	A	G	1: 83,257,257	V1616A	probably damaging	Het
Sulf1	T	C	1: 12,842,755	C738R	probably damaging	Het
Suz12	T	A	11: 80,002,172	C38*	probably null	Het
Ttn	T	C	2: 76,720,498	T23190A	probably damaging	Het
Twnk	A	G	19: 45,007,416	D96G	probably benign	Het
Vcan	T	A	13: 89,712,381	N289I	probably damaging	Het
Vmn2r120	A	T	17: 57,509,187	S723T	probably damaging	Het
Vmn2r97	A	T	17: 18,914,508	I63F	probably benign	Het
Washc5	T	C	15: 59,350,172	N125S	probably benign	Het
Zfp865	A	G	7: 5,030,549	Y511C	probably damaging	Het

Other mutations in Baz2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Baz2b	APN	2	59912795	missense	probably benign	0.02
IGL00476:Baz2b	APN	2	59913739	missense	probably benign	0.06
IGL00489:Baz2b	APN	2	59957675	nonsense	probably null
IGL00514:Baz2b	APN	2	59962477	missense	probably benign	0.11
IGL00678:Baz2b	APN	2	60006183	missense	unknown
IGL01348:Baz2b	APN	2	59933687	missense	possibly damaging	0.95
IGL01354:Baz2b	APN	2	59968889	missense	probably benign	0.18
IGL01924:Baz2b	APN	2	59935271	missense	probably damaging	1.00
IGL02125:Baz2b	APN	2	59968640	missense	probably benign	0.12
IGL02314:Baz2b	APN	2	59962227	missense	probably benign
IGL02370:Baz2b	APN	2	59923589	missense	possibly damaging	0.77
IGL02473:Baz2b	APN	2	59960063	missense	probably benign	0.40
IGL02499:Baz2b	APN	2	59901496	missense	possibly damaging	0.60
IGL02609:Baz2b	APN	2	59917369	missense	possibly damaging	0.77
IGL02705:Baz2b	APN	2	59948260	missense	possibly damaging	0.92
IGL02711:Baz2b	APN	2	59917505	unclassified	probably benign
IGL02716:Baz2b	APN	2	59962524	missense	possibly damaging	0.53
IGL02724:Baz2b	APN	2	59977374	missense	possibly damaging	0.70
IGL02750:Baz2b	APN	2	59968658	missense	possibly damaging	0.73
IGL02869:Baz2b	APN	2	59977528	missense	probably benign	0.00
IGL02886:Baz2b	APN	2	59957743	splice site	probably null
IGL02892:Baz2b	APN	2	59900736	missense	probably damaging	1.00
IGL03132:Baz2b	APN	2	59907753	splice site	probably benign
IGL03183:Baz2b	APN	2	59903296	missense	probably benign	0.10
IGL03197:Baz2b	APN	2	59901554	missense	possibly damaging	0.74
R0054:Baz2b	UTSW	2	59932166	missense	probably damaging	1.00
R0054:Baz2b	UTSW	2	59932166	missense	probably damaging	1.00
R0122:Baz2b	UTSW	2	59913619	splice site	probably null
R0136:Baz2b	UTSW	2	59901954	missense	probably benign	0.22
R0144:Baz2b	UTSW	2	59907495	missense	probably damaging	0.98
R0403:Baz2b	UTSW	2	59969377	missense	possibly damaging	0.70
R0498:Baz2b	UTSW	2	59901996	unclassified	probably benign
R0528:Baz2b	UTSW	2	59936739	missense	probably damaging	1.00
R1025:Baz2b	UTSW	2	59962482	missense	probably benign	0.06
R1470:Baz2b	UTSW	2	59978546	missense	possibly damaging	0.53
R1470:Baz2b	UTSW	2	59978546	missense	possibly damaging	0.53
R1510:Baz2b	UTSW	2	59922209	missense	probably damaging	1.00
R1511:Baz2b	UTSW	2	59962024	missense	probably benign	0.12
R1514:Baz2b	UTSW	2	59962326	missense	probably benign	0.13
R1519:Baz2b	UTSW	2	59948254	missense	possibly damaging	0.50
R1523:Baz2b	UTSW	2	59968637	missense	possibly damaging	0.47
R1630:Baz2b	UTSW	2	60006130	missense	unknown
R1641:Baz2b	UTSW	2	59912890	missense	probably damaging	0.99
R1674:Baz2b	UTSW	2	59912992	missense	possibly damaging	0.53
R1778:Baz2b	UTSW	2	60006136	missense	unknown
R1826:Baz2b	UTSW	2	59968733	missense	probably benign	0.12
R1835:Baz2b	UTSW	2	59901819	missense	probably benign	0.02
R1954:Baz2b	UTSW	2	59968743	missense	probably benign	0.12
R1981:Baz2b	UTSW	2	59923680	missense	possibly damaging	0.95
R2029:Baz2b	UTSW	2	59912723	unclassified	probably benign
R2567:Baz2b	UTSW	2	59913911	missense	possibly damaging	0.82
R2842:Baz2b	UTSW	2	59913004	missense	probably benign	0.27
R2848:Baz2b	UTSW	2	59924666	missense	possibly damaging	0.64
R3809:Baz2b	UTSW	2	59968896	missense	probably benign	0.12
R3935:Baz2b	UTSW	2	59912761	missense	possibly damaging	0.81
R3936:Baz2b	UTSW	2	59912761	missense	possibly damaging	0.81
R4072:Baz2b	UTSW	2	59912573	splice site	probably null
R4182:Baz2b	UTSW	2	60098457	intron	probably benign
R4255:Baz2b	UTSW	2	59920572	unclassified	probably benign
R4359:Baz2b	UTSW	2	59901613	missense	possibly damaging	0.87
R4716:Baz2b	UTSW	2	59969255	missense	probably benign	0.06
R4743:Baz2b	UTSW	2	59913911	missense	probably benign	0.01
R4772:Baz2b	UTSW	2	59958451	missense	probably damaging	0.96
R4858:Baz2b	UTSW	2	59907743	missense	probably benign
R4868:Baz2b	UTSW	2	59924882	missense	possibly damaging	0.65
R4872:Baz2b	UTSW	2	59942759	splice site	probably null
R4889:Baz2b	UTSW	2	59936726	missense	probably damaging	1.00
R4890:Baz2b	UTSW	2	59926039	missense	probably damaging	0.99
R4914:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R4915:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R4918:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R5027:Baz2b	UTSW	2	60098644	intron	probably benign
R5031:Baz2b	UTSW	2	59912807	missense	probably benign	0.00
R5082:Baz2b	UTSW	2	59901491	nonsense	probably null
R5133:Baz2b	UTSW	2	59962024	missense	probably benign	0.12
R5276:Baz2b	UTSW	2	59962614	missense	probably benign	0.40
R5279:Baz2b	UTSW	2	59932152	missense	probably damaging	1.00
R5294:Baz2b	UTSW	2	59978602	missense	probably benign	0.11
R5447:Baz2b	UTSW	2	59913988	missense	probably damaging	0.99
R5903:Baz2b	UTSW	2	59959889	missense	probably damaging	0.99
R5910:Baz2b	UTSW	2	59977426	missense	possibly damaging	0.88
R6140:Baz2b	UTSW	2	59912527	missense	probably damaging	0.99
R6195:Baz2b	UTSW	2	59907511	missense	possibly damaging	0.89
R6199:Baz2b	UTSW	2	59978675	missense	probably benign	0.00
R6208:Baz2b	UTSW	2	59924806	missense	probably damaging	1.00
R6233:Baz2b	UTSW	2	59907511	missense	possibly damaging	0.89
R6276:Baz2b	UTSW	2	59948223	missense	probably damaging	1.00
R6324:Baz2b	UTSW	2	59906948	missense	probably damaging	1.00
R6490:Baz2b	UTSW	2	59901729	missense	probably damaging	1.00
R6578:Baz2b	UTSW	2	59969279	missense	possibly damaging	0.47
R6720:Baz2b	UTSW	2	59924890	missense	probably damaging	1.00
R6760:Baz2b	UTSW	2	59962432	missense	probably benign	0.40
R6836:Baz2b	UTSW	2	59917425	missense	probably damaging	1.00
R6859:Baz2b	UTSW	2	59901530	missense	probably benign	0.01
R6916:Baz2b	UTSW	2	59968776	missense	probably benign
R6978:Baz2b	UTSW	2	59907715	missense	possibly damaging	0.84
R7037:Baz2b	UTSW	2	59933670	critical splice donor site	probably null
R7112:Baz2b	UTSW	2	59962184	missense	possibly damaging	0.53
R7117:Baz2b	UTSW	2	59912497	missense
R7198:Baz2b	UTSW	2	59962206	missense	probably benign	0.00
R7270:Baz2b	UTSW	2	59962492	missense	possibly damaging	0.96
R7282:Baz2b	UTSW	2	59920437	missense	probably benign	0.17
R7464:Baz2b	UTSW	2	59977448	missense	possibly damaging	0.53
R7609:Baz2b	UTSW	2	59962473	missense	probably benign	0.40
R7703:Baz2b	UTSW	2	59917425	missense	probably damaging	1.00
R7850:Baz2b	UTSW	2	59936716	missense	probably damaging	0.98
R7851:Baz2b	UTSW	2	59936716	missense	probably damaging	0.98
R7988:Baz2b	UTSW	2	59962141	missense	possibly damaging	0.53
R8079:Baz2b	UTSW	2	59900768	missense	probably damaging	1.00
R8084:Baz2b	UTSW	2	59962236	missense	probably benign
R8343:Baz2b	UTSW	2	59901514	missense	probably damaging	1.00
R8348:Baz2b	UTSW	2	59911793	missense
R8438:Baz2b	UTSW	2	59917484	nonsense	probably null
R8448:Baz2b	UTSW	2	59911793	missense
R8511:Baz2b	UTSW	2	59901814	missense	probably benign
R8893:Baz2b	UTSW	2	59924805	missense	probably damaging	0.96
R8947:Baz2b	UTSW	2	59948239	missense	probably benign	0.06
R8998:Baz2b	UTSW	2	59969264	missense	probably benign	0.02
R9241:Baz2b	UTSW	2	59913649	missense	probably benign	0.01
R9245:Baz2b	UTSW	2	59912987	missense	probably benign
R9577:Baz2b	UTSW	2	59978687	missense	probably benign	0.06
R9581:Baz2b	UTSW	2	59968956	missense	probably benign
R9601:Baz2b	UTSW	2	59901503	missense	possibly damaging	0.66
R9613:Baz2b	UTSW	2	59901480	missense	probably benign	0.09
R9639:Baz2b	UTSW	2	59901484	missense	probably benign	0.01
X0011:Baz2b	UTSW	2	59977361	missense	possibly damaging	0.53
X0053:Baz2b	UTSW	2	59900675	missense	probably damaging	1.00
X0064:Baz2b	UTSW	2	59969282	missense	probably benign
Z1088:Baz2b	UTSW	2	59960015	missense	probably damaging	1.00
Z1177:Baz2b	UTSW	2	59977520	missense	probably benign	0.01
Z1188:Baz2b	UTSW	2	59977405	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCTACTTCAACAGCCACTGG -3'
(R):5'- CCTCCAACTCTTTAGATGAATTGG -3'

Sequencing Primer
(F):5'- ACTGGCTGAGCGCTGGAG -3'
(R):5'- TATGTATCAGAGGGTAACTTGCAG -3'

Posted On

2018-10-18