Incidental Mutation 'R6880:Alg5'
ID536603
Institutional Source Beutler Lab
Gene Symbol Alg5
Ensembl Gene ENSMUSG00000036632
Gene Nameasparagine-linked glycosylation 5 (dolichyl-phosphate beta-glucosyltransferase)
Synonyms2600005J22Rik, 1500026A19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R6880 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location54735539-54751318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54738843 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 43 (E43G)
Ref Sequence ENSEMBL: ENSMUSP00000119260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029316] [ENSMUST00000044567] [ENSMUST00000141191] [ENSMUST00000153224] [ENSMUST00000154787] [ENSMUST00000155273]
Predicted Effect probably benign
Transcript: ENSMUST00000029316
SMART Domains Protein: ENSMUSP00000029316
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 31 166 2.3e-29 PFAM
Pfam:RNase_PH_C 191 258 8.9e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044567
AA Change: E43G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035879
Gene: ENSMUSG00000036632
AA Change: E43G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 63 174 2.1e-10 PFAM
Pfam:Glycos_transf_2 68 250 2.9e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141191
AA Change: E43G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118818
Gene: ENSMUSG00000036632
AA Change: E43G

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153224
SMART Domains Protein: ENSMUSP00000118780
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 31 130 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154787
SMART Domains Protein: ENSMUSP00000115876
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 19 106 5.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155273
AA Change: E43G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119260
Gene: ENSMUSG00000036632
AA Change: E43G

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 family. The encoded protein participates in glucosylation of the oligomannose core in N-linked glycosylation of proteins. The addition of glucose residues to the oligomannose core is necessary to ensure substrate recognition, and therefore, effectual transfer of the oligomannose core to the nascent glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
PHENOTYPE: Embryos homozygous for an ENU-induced mutation arrest unturned at E9.5 and display no left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,069,705 probably null Het
Aff3 T C 1: 38,535,162 H206R probably damaging Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Ankrd36 T C 11: 5,628,748 L4P probably damaging Het
Ano1 T C 7: 144,644,742 Y345C probably benign Het
Atf7ip A G 6: 136,561,040 I432V probably damaging Het
B230307C23Rik T C 16: 97,997,427 probably benign Het
Baz2b T A 2: 59,912,939 N1563Y probably damaging Het
Bhlha15 A T 5: 144,191,633 T188S probably damaging Het
Cbr3 T C 16: 93,690,538 V203A probably benign Het
Cpsf1 T C 15: 76,602,539 T266A probably benign Het
Dnah7c T C 1: 46,527,671 Y681H probably damaging Het
Dock2 C T 11: 34,688,452 probably null Het
Dsc1 T A 18: 20,088,372 D682V probably damaging Het
Fkbp15 A T 4: 62,336,495 I256N possibly damaging Het
Foxd1 A C 13: 98,354,717 D33A unknown Het
Gid4 T A 11: 60,436,435 F149I probably damaging Het
Hmcn2 G T 2: 31,343,056 V206L probably damaging Het
Ighg2b T C 12: 113,307,106 I135V Het
Ighv1-24 T C 12: 114,773,043 Y79C possibly damaging Het
Impg1 T A 9: 80,404,800 D167V probably damaging Het
Jakmip1 T C 5: 37,105,623 S372P possibly damaging Het
Kcnb1 T C 2: 167,105,807 T374A probably damaging Het
Lrrn4 A G 2: 132,872,112 S305P probably damaging Het
Ltbp1 C T 17: 75,321,049 T1179I possibly damaging Het
Mab21l2 A G 3: 86,547,156 I179T possibly damaging Het
Myo5b A T 18: 74,722,430 H1230L probably benign Het
Myocos T C 1: 162,657,033 probably null Het
Nipa2 T C 7: 55,933,251 T249A probably damaging Het
Oas1a C A 5: 120,901,940 R196L probably damaging Het
Olfr228 A G 2: 86,483,725 F6L probably benign Het
Olfr235 A G 19: 12,268,610 I127V probably benign Het
Olfr700 A T 7: 106,805,812 S217T probably damaging Het
Phxr2 G A 10: 99,126,084 probably benign Het
Pigq A G 17: 25,934,828 L85P probably damaging Het
Pla2g4a T A 1: 149,851,451 D518V possibly damaging Het
Pm20d1 A G 1: 131,804,101 K294E probably benign Het
Polr3d C A 14: 70,440,015 R307L probably benign Het
Pou5f2 T C 13: 78,025,494 L185P possibly damaging Het
Prex2 A T 1: 11,132,384 N506Y probably damaging Het
Proser1 T A 3: 53,477,839 S381T probably benign Het
Prpf4b T C 13: 34,894,453 V682A possibly damaging Het
Prr14l A T 5: 32,830,867 L428Q probably benign Het
Prss23 A G 7: 89,510,825 V12A probably benign Het
Qk T C 17: 10,215,447 D321G probably benign Het
Rab11fip5 A G 6: 85,348,845 L193P probably damaging Het
Retreg1 T G 15: 25,971,739 L245R probably damaging Het
Rfc1 T C 5: 65,277,386 N679S probably benign Het
Rpl4 C T 9: 64,177,053 A220V probably damaging Het
Rxra G A 2: 27,748,656 E224K possibly damaging Het
Slc26a7 A G 4: 14,516,159 C557R possibly damaging Het
Sncaip A G 18: 52,869,064 K219R probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sphkap A G 1: 83,257,257 V1616A probably damaging Het
Sulf1 T C 1: 12,842,755 C738R probably damaging Het
Suz12 T A 11: 80,002,172 C38* probably null Het
Ttn T C 2: 76,720,498 T23190A probably damaging Het
Twnk A G 19: 45,007,416 D96G probably benign Het
Vcan T A 13: 89,712,381 N289I probably damaging Het
Vmn2r120 A T 17: 57,509,187 S723T probably damaging Het
Vmn2r97 A T 17: 18,914,508 I63F probably benign Het
Washc5 T C 15: 59,350,172 N125S probably benign Het
Zfp865 A G 7: 5,030,549 Y511C probably damaging Het
Other mutations in Alg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Alg5 APN 3 54744719 splice site probably benign
R2008:Alg5 UTSW 3 54746473 missense possibly damaging 0.92
R3428:Alg5 UTSW 3 54735585 start codon destroyed probably null
R3547:Alg5 UTSW 3 54749315 missense probably benign 0.15
R4372:Alg5 UTSW 3 54738955 critical splice donor site probably null
R4764:Alg5 UTSW 3 54746473 missense possibly damaging 0.92
R5128:Alg5 UTSW 3 54742137 splice site probably null
R5476:Alg5 UTSW 3 54746598 missense probably benign 0.01
R5638:Alg5 UTSW 3 54738833 missense probably benign 0.22
R6897:Alg5 UTSW 3 54748642 missense probably benign
R7317:Alg5 UTSW 3 54749331 missense probably benign 0.00
R8244:Alg5 UTSW 3 54738800 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCTGGCTGCCATGAAAC -3'
(R):5'- TCCAACTCTGTACTCCTCAGGG -3'

Sequencing Primer
(F):5'- GAATCACCTCCAGGACTGTTAG -3'
(R):5'- CTCAGGGAGGGCAGACACTG -3'
Posted On2018-10-18