Incidental Mutation 'R6880:Jakmip1'
ID 536608
Institutional Source Beutler Lab
Gene Symbol Jakmip1
Ensembl Gene ENSMUSG00000113373
Gene Name janus kinase and microtubule interacting protein 1
Synonyms 5830437M04Rik, C330021K24Rik, Gababrbp, Marlin-1
MMRRC Submission 044976-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R6880 (G1)
Quality Score 188.009
Status Validated
Chromosome 5
Chromosomal Location 37185679-37307951 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37262967 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 372 (S372P)
Ref Sequence ENSEMBL: ENSMUSP00000038504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043794] [ENSMUST00000121010] [ENSMUST00000137019] [ENSMUST00000174629] [ENSMUST00000232332]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000043794
AA Change: S372P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038504
Gene: ENSMUSG00000063646
AA Change: S372P

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
coiled coil region 133 227 N/A INTRINSIC
coiled coil region 284 377 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
low complexity region 467 487 N/A INTRINSIC
coiled coil region 515 604 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121010
AA Change: S372P

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113624
Gene: ENSMUSG00000063646
AA Change: S372P

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
coiled coil region 133 227 N/A INTRINSIC
coiled coil region 284 377 N/A INTRINSIC
Pfam:JAKMIP_CC3 415 612 3.3e-85 PFAM
coiled coil region 678 819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137019
SMART Domains Protein: ENSMUSP00000122584
Gene: ENSMUSG00000063646

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
coiled coil region 133 227 N/A INTRINSIC
coiled coil region 284 330 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174629
AA Change: S207P

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134288
Gene: ENSMUSG00000063646
AA Change: S207P

DomainStartEndE-ValueType
coiled coil region 13 52 N/A INTRINSIC
coiled coil region 119 212 N/A INTRINSIC
low complexity region 282 302 N/A INTRINSIC
coiled coil region 330 422 N/A INTRINSIC
coiled coil region 493 634 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000232332
AA Change: S372P

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 97% (62/64)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in social deficits, stereotyped activity, abnormal postnatal vocalizations, reduced anxiety/increased impulsivity and glutamatergic NMDAR signaling deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,123,854 (GRCm39) probably null Het
Aff3 T C 1: 38,574,243 (GRCm39) H206R probably damaging Het
Aff3 T C 1: 38,666,209 (GRCm39) D5G possibly damaging Het
Alg5 A G 3: 54,646,264 (GRCm39) E43G probably damaging Het
Ankrd36 T C 11: 5,578,748 (GRCm39) L4P probably damaging Het
Ano1 T C 7: 144,198,479 (GRCm39) Y345C probably benign Het
Atf7ip A G 6: 136,538,038 (GRCm39) I432V probably damaging Het
B230307C23Rik T C 16: 97,798,627 (GRCm39) probably benign Het
Baz2b T A 2: 59,743,283 (GRCm39) N1563Y probably damaging Het
Bhlha15 A T 5: 144,128,451 (GRCm39) T188S probably damaging Het
Cbr3 T C 16: 93,487,426 (GRCm39) V203A probably benign Het
Cpsf1 T C 15: 76,486,739 (GRCm39) T266A probably benign Het
Dnah7c T C 1: 46,566,831 (GRCm39) Y681H probably damaging Het
Dock2 C T 11: 34,579,279 (GRCm39) probably null Het
Dsc1 T A 18: 20,221,429 (GRCm39) D682V probably damaging Het
Fkbp15 A T 4: 62,254,732 (GRCm39) I256N possibly damaging Het
Foxd1 A C 13: 98,491,225 (GRCm39) D33A unknown Het
Gid4 T A 11: 60,327,261 (GRCm39) F149I probably damaging Het
Hmcn2 G T 2: 31,233,068 (GRCm39) V206L probably damaging Het
Ighg2b T C 12: 113,270,726 (GRCm39) I135V Het
Ighv1-24 T C 12: 114,736,663 (GRCm39) Y79C possibly damaging Het
Impg1 T A 9: 80,312,082 (GRCm39) D167V probably damaging Het
Kcnb1 T C 2: 166,947,727 (GRCm39) T374A probably damaging Het
Lrrn4 A G 2: 132,714,032 (GRCm39) S305P probably damaging Het
Ltbp1 C T 17: 75,628,044 (GRCm39) T1179I possibly damaging Het
Mab21l2 A G 3: 86,454,463 (GRCm39) I179T possibly damaging Het
Myo5b A T 18: 74,855,501 (GRCm39) H1230L probably benign Het
Myocos T C 1: 162,484,602 (GRCm39) probably null Het
Nipa2 T C 7: 55,582,999 (GRCm39) T249A probably damaging Het
Oas1a C A 5: 121,040,003 (GRCm39) R196L probably damaging Het
Or2ag18 A T 7: 106,405,019 (GRCm39) S217T probably damaging Het
Or5an11 A G 19: 12,245,974 (GRCm39) I127V probably benign Het
Or8k41 A G 2: 86,314,069 (GRCm39) F6L probably benign Het
Phxr2 G A 10: 98,961,946 (GRCm39) probably benign Het
Pigq A G 17: 26,153,802 (GRCm39) L85P probably damaging Het
Pla2g4a T A 1: 149,727,202 (GRCm39) D518V possibly damaging Het
Pm20d1 A G 1: 131,731,839 (GRCm39) K294E probably benign Het
Polr3d C A 14: 70,677,455 (GRCm39) R307L probably benign Het
Pou5f2 T C 13: 78,173,613 (GRCm39) L185P possibly damaging Het
Prex2 A T 1: 11,202,608 (GRCm39) N506Y probably damaging Het
Proser1 T A 3: 53,385,260 (GRCm39) S381T probably benign Het
Prpf4b T C 13: 35,078,436 (GRCm39) V682A possibly damaging Het
Prr14l A T 5: 32,988,211 (GRCm39) L428Q probably benign Het
Prss23 A G 7: 89,160,033 (GRCm39) V12A probably benign Het
Qki T C 17: 10,434,376 (GRCm39) D321G probably benign Het
Rab11fip5 A G 6: 85,325,827 (GRCm39) L193P probably damaging Het
Retreg1 T G 15: 25,971,825 (GRCm39) L245R probably damaging Het
Rfc1 T C 5: 65,434,729 (GRCm39) N679S probably benign Het
Rpl4 C T 9: 64,084,335 (GRCm39) A220V probably damaging Het
Rxra G A 2: 27,638,668 (GRCm39) E224K possibly damaging Het
Slc26a7 A G 4: 14,516,159 (GRCm39) C557R possibly damaging Het
Sncaip A G 18: 53,002,136 (GRCm39) K219R probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Sphkap A G 1: 83,234,978 (GRCm39) V1616A probably damaging Het
Sulf1 T C 1: 12,912,979 (GRCm39) C738R probably damaging Het
Suz12 T A 11: 79,892,998 (GRCm39) C38* probably null Het
Ttn T C 2: 76,550,842 (GRCm39) T23190A probably damaging Het
Twnk A G 19: 44,995,855 (GRCm39) D96G probably benign Het
Vcan T A 13: 89,860,500 (GRCm39) N289I probably damaging Het
Vmn2r120 A T 17: 57,816,187 (GRCm39) S723T probably damaging Het
Vmn2r97 A T 17: 19,134,770 (GRCm39) I63F probably benign Het
Washc5 T C 15: 59,222,021 (GRCm39) N125S probably benign Het
Zfp865 A G 7: 5,033,548 (GRCm39) Y511C probably damaging Het
Other mutations in Jakmip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Jakmip1 APN 5 37,242,750 (GRCm39) nonsense probably null
IGL01350:Jakmip1 APN 5 37,242,775 (GRCm39) missense probably benign 0.01
IGL01613:Jakmip1 APN 5 37,258,112 (GRCm39) missense probably damaging 1.00
IGL01875:Jakmip1 APN 5 37,278,324 (GRCm39) missense probably damaging 0.99
IGL02006:Jakmip1 APN 5 37,278,331 (GRCm39) missense probably damaging 0.99
IGL02225:Jakmip1 APN 5 37,262,200 (GRCm39) missense probably damaging 0.99
IGL02389:Jakmip1 APN 5 37,258,187 (GRCm39) nonsense probably null
R0036:Jakmip1 UTSW 5 37,291,648 (GRCm39) missense probably null 0.38
R0194:Jakmip1 UTSW 5 37,291,627 (GRCm39) missense possibly damaging 0.77
R0442:Jakmip1 UTSW 5 37,292,897 (GRCm39) splice site probably null
R0555:Jakmip1 UTSW 5 37,276,217 (GRCm39) missense probably damaging 0.99
R1053:Jakmip1 UTSW 5 37,291,593 (GRCm39) missense possibly damaging 0.59
R1158:Jakmip1 UTSW 5 37,248,472 (GRCm39) missense possibly damaging 0.94
R1470:Jakmip1 UTSW 5 37,258,182 (GRCm39) missense probably damaging 1.00
R1470:Jakmip1 UTSW 5 37,258,182 (GRCm39) missense probably damaging 1.00
R2339:Jakmip1 UTSW 5 37,248,543 (GRCm39) missense probably benign 0.05
R2397:Jakmip1 UTSW 5 37,258,087 (GRCm39) missense probably damaging 0.99
R2425:Jakmip1 UTSW 5 37,299,149 (GRCm39) nonsense probably null
R2973:Jakmip1 UTSW 5 37,248,871 (GRCm39) missense probably damaging 1.00
R4758:Jakmip1 UTSW 5 37,285,966 (GRCm39) missense probably damaging 0.99
R4918:Jakmip1 UTSW 5 37,248,619 (GRCm39) missense probably damaging 1.00
R5212:Jakmip1 UTSW 5 37,262,245 (GRCm39) missense probably benign 0.05
R5842:Jakmip1 UTSW 5 37,264,612 (GRCm39) missense probably damaging 1.00
R5926:Jakmip1 UTSW 5 37,242,624 (GRCm39) unclassified probably benign
R6258:Jakmip1 UTSW 5 37,299,104 (GRCm39) nonsense probably null
R6776:Jakmip1 UTSW 5 37,344,498 (GRCm39) missense probably damaging 0.97
R6961:Jakmip1 UTSW 5 37,330,697 (GRCm39) missense probably damaging 0.98
R6982:Jakmip1 UTSW 5 37,282,285 (GRCm39) missense probably damaging 1.00
R7109:Jakmip1 UTSW 5 37,332,109 (GRCm39) nonsense probably null
R7173:Jakmip1 UTSW 5 37,248,708 (GRCm39) missense probably damaging 1.00
R7293:Jakmip1 UTSW 5 37,284,817 (GRCm39) missense probably benign 0.00
R7294:Jakmip1 UTSW 5 37,274,804 (GRCm39) missense possibly damaging 0.65
R7361:Jakmip1 UTSW 5 37,276,148 (GRCm39) missense probably damaging 1.00
R7384:Jakmip1 UTSW 5 37,330,551 (GRCm39) missense possibly damaging 0.70
R7454:Jakmip1 UTSW 5 37,332,498 (GRCm39) missense probably damaging 0.96
R7477:Jakmip1 UTSW 5 37,330,915 (GRCm39) missense probably benign 0.00
R7579:Jakmip1 UTSW 5 37,284,802 (GRCm39) missense possibly damaging 0.95
R7617:Jakmip1 UTSW 5 37,328,345 (GRCm39) missense possibly damaging 0.85
R7651:Jakmip1 UTSW 5 37,291,617 (GRCm39) missense probably damaging 0.97
R7702:Jakmip1 UTSW 5 37,274,841 (GRCm39) missense probably damaging 1.00
R7822:Jakmip1 UTSW 5 37,332,524 (GRCm39) missense probably damaging 0.99
R7888:Jakmip1 UTSW 5 37,262,208 (GRCm39) missense probably damaging 1.00
R7942:Jakmip1 UTSW 5 37,331,182 (GRCm39) missense probably benign 0.01
R7949:Jakmip1 UTSW 5 37,339,492 (GRCm39) missense probably damaging 1.00
R8015:Jakmip1 UTSW 5 37,317,109 (GRCm39) missense unknown
R8039:Jakmip1 UTSW 5 37,258,116 (GRCm39) missense probably damaging 1.00
R8044:Jakmip1 UTSW 5 37,311,988 (GRCm39) missense unknown
R8070:Jakmip1 UTSW 5 37,330,631 (GRCm39) missense probably benign 0.10
R8410:Jakmip1 UTSW 5 37,274,828 (GRCm39) missense possibly damaging 0.91
R8779:Jakmip1 UTSW 5 37,386,672 (GRCm39) missense unknown
R8946:Jakmip1 UTSW 5 37,343,084 (GRCm39) critical splice donor site probably null
R8992:Jakmip1 UTSW 5 37,274,882 (GRCm39) missense probably benign 0.23
R9007:Jakmip1 UTSW 5 37,332,857 (GRCm39) missense probably benign 0.04
R9531:Jakmip1 UTSW 5 37,332,407 (GRCm39) missense probably damaging 0.96
R9621:Jakmip1 UTSW 5 37,274,812 (GRCm39) missense unknown
RF014:Jakmip1 UTSW 5 37,331,870 (GRCm39) missense possibly damaging 0.59
T0722:Jakmip1 UTSW 5 37,276,247 (GRCm39) missense probably damaging 1.00
Z1088:Jakmip1 UTSW 5 37,278,330 (GRCm39) missense probably damaging 1.00
Z1177:Jakmip1 UTSW 5 37,332,651 (GRCm39) frame shift probably null
Z1177:Jakmip1 UTSW 5 37,248,927 (GRCm39) missense probably damaging 1.00
Z1190:Jakmip1 UTSW 5 37,331,308 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCATTCCTGTGAGCATC -3'
(R):5'- CTGCTTCCTGGAGATCACAG -3'

Sequencing Primer
(F):5'- GTGAGCATCACTGACCACAC -3'
(R):5'- TTCCTGGAGATCACAGGGGAC -3'
Posted On 2018-10-18