Incidental Mutation 'R6880:Atf7ip'
ID536613
Institutional Source Beutler Lab
Gene Symbol Atf7ip
Ensembl Gene ENSMUSG00000030213
Gene Nameactivating transcription factor 7 interacting protein
SynonymsMcaf1, 2610204M12Rik, AM, ATFa-associated Modulator
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.855) question?
Stock #R6880 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location136506167-136610862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136561040 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 432 (I432V)
Ref Sequence ENSEMBL: ENSMUSP00000140502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032335] [ENSMUST00000185724] [ENSMUST00000186577] [ENSMUST00000186742] [ENSMUST00000187429] [ENSMUST00000189535] [ENSMUST00000203988]
Predicted Effect probably benign
Transcript: ENSMUST00000032335
AA Change: I424V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032335
Gene: ENSMUSG00000030213
AA Change: I424V

DomainStartEndE-ValueType
internal_repeat_1 123 144 9.59e-5 PROSPERO
internal_repeat_1 143 164 9.59e-5 PROSPERO
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 567 582 N/A INTRINSIC
Pfam:ATF7IP_BD 598 813 5.5e-62 PFAM
low complexity region 864 889 N/A INTRINSIC
PDB:2RPQ|B 974 1017 5e-7 PDB
low complexity region 1022 1036 N/A INTRINSIC
low complexity region 1038 1050 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1168 1192 N/A INTRINSIC
FN3 1194 1288 3.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185724
AA Change: I424V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140458
Gene: ENSMUSG00000030213
AA Change: I424V

DomainStartEndE-ValueType
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186577
SMART Domains Protein: ENSMUSP00000140121
Gene: ENSMUSG00000030213

DomainStartEndE-ValueType
coiled coil region 71 101 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186742
Predicted Effect probably damaging
Transcript: ENSMUST00000187429
AA Change: I432V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140502
Gene: ENSMUSG00000030213
AA Change: I432V

DomainStartEndE-ValueType
internal_repeat_1 123 144 8.96e-5 PROSPERO
internal_repeat_1 143 164 8.96e-5 PROSPERO
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 567 582 N/A INTRINSIC
coiled coil region 666 696 N/A INTRINSIC
low complexity region 701 711 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 774 803 N/A INTRINSIC
low complexity region 864 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189535
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000203988
SMART Domains Protein: ENSMUSP00000145022
Gene: ENSMUSG00000030213

DomainStartEndE-ValueType
Pfam:ATF7IP_BD 3 73 1.6e-26 PFAM
Meta Mutation Damage Score 0.0839 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATF7IP is a multifunctional nuclear protein that associates with heterochromatin. It can act as a transcriptional coactivator or corepressor depending upon its binding partners (summary by Liu et al., 2009 [PubMed 19106100]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,069,705 probably null Het
Aff3 T C 1: 38,535,162 H206R probably damaging Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Alg5 A G 3: 54,738,843 E43G probably damaging Het
Ankrd36 T C 11: 5,628,748 L4P probably damaging Het
Ano1 T C 7: 144,644,742 Y345C probably benign Het
B230307C23Rik T C 16: 97,997,427 probably benign Het
Baz2b T A 2: 59,912,939 N1563Y probably damaging Het
Bhlha15 A T 5: 144,191,633 T188S probably damaging Het
Cbr3 T C 16: 93,690,538 V203A probably benign Het
Cpsf1 T C 15: 76,602,539 T266A probably benign Het
Dnah7c T C 1: 46,527,671 Y681H probably damaging Het
Dock2 C T 11: 34,688,452 probably null Het
Dsc1 T A 18: 20,088,372 D682V probably damaging Het
Fkbp15 A T 4: 62,336,495 I256N possibly damaging Het
Foxd1 A C 13: 98,354,717 D33A unknown Het
Gid4 T A 11: 60,436,435 F149I probably damaging Het
Hmcn2 G T 2: 31,343,056 V206L probably damaging Het
Ighg2b T C 12: 113,307,106 I135V Het
Ighv1-24 T C 12: 114,773,043 Y79C possibly damaging Het
Impg1 T A 9: 80,404,800 D167V probably damaging Het
Jakmip1 T C 5: 37,105,623 S372P possibly damaging Het
Kcnb1 T C 2: 167,105,807 T374A probably damaging Het
Lrrn4 A G 2: 132,872,112 S305P probably damaging Het
Ltbp1 C T 17: 75,321,049 T1179I possibly damaging Het
Mab21l2 A G 3: 86,547,156 I179T possibly damaging Het
Myo5b A T 18: 74,722,430 H1230L probably benign Het
Myocos T C 1: 162,657,033 probably null Het
Nipa2 T C 7: 55,933,251 T249A probably damaging Het
Oas1a C A 5: 120,901,940 R196L probably damaging Het
Olfr228 A G 2: 86,483,725 F6L probably benign Het
Olfr235 A G 19: 12,268,610 I127V probably benign Het
Olfr700 A T 7: 106,805,812 S217T probably damaging Het
Phxr2 G A 10: 99,126,084 probably benign Het
Pigq A G 17: 25,934,828 L85P probably damaging Het
Pla2g4a T A 1: 149,851,451 D518V possibly damaging Het
Pm20d1 A G 1: 131,804,101 K294E probably benign Het
Polr3d C A 14: 70,440,015 R307L probably benign Het
Pou5f2 T C 13: 78,025,494 L185P possibly damaging Het
Prex2 A T 1: 11,132,384 N506Y probably damaging Het
Proser1 T A 3: 53,477,839 S381T probably benign Het
Prpf4b T C 13: 34,894,453 V682A possibly damaging Het
Prr14l A T 5: 32,830,867 L428Q probably benign Het
Prss23 A G 7: 89,510,825 V12A probably benign Het
Qk T C 17: 10,215,447 D321G probably benign Het
Rab11fip5 A G 6: 85,348,845 L193P probably damaging Het
Retreg1 T G 15: 25,971,739 L245R probably damaging Het
Rfc1 T C 5: 65,277,386 N679S probably benign Het
Rpl4 C T 9: 64,177,053 A220V probably damaging Het
Rxra G A 2: 27,748,656 E224K possibly damaging Het
Slc26a7 A G 4: 14,516,159 C557R possibly damaging Het
Sncaip A G 18: 52,869,064 K219R probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sphkap A G 1: 83,257,257 V1616A probably damaging Het
Sulf1 T C 1: 12,842,755 C738R probably damaging Het
Suz12 T A 11: 80,002,172 C38* probably null Het
Ttn T C 2: 76,720,498 T23190A probably damaging Het
Twnk A G 19: 45,007,416 D96G probably benign Het
Vcan T A 13: 89,712,381 N289I probably damaging Het
Vmn2r120 A T 17: 57,509,187 S723T probably damaging Het
Vmn2r97 A T 17: 18,914,508 I63F probably benign Het
Washc5 T C 15: 59,350,172 N125S probably benign Het
Zfp865 A G 7: 5,030,549 Y511C probably damaging Het
Other mutations in Atf7ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Atf7ip APN 6 136560681 missense probably benign 0.00
IGL01483:Atf7ip APN 6 136587459 missense probably damaging 1.00
IGL02313:Atf7ip APN 6 136606720 missense probably damaging 0.99
IGL02319:Atf7ip APN 6 136593118 missense probably benign 0.01
IGL02547:Atf7ip APN 6 136603276 splice site probably benign
IGL02869:Atf7ip APN 6 136606579 missense probably damaging 0.99
IGL02895:Atf7ip APN 6 136560688 missense probably damaging 0.99
IGL02967:Atf7ip APN 6 136606727 missense probably damaging 0.98
IGL03026:Atf7ip APN 6 136605382 missense possibly damaging 0.79
R0024:Atf7ip UTSW 6 136599820 splice site probably benign
R0045:Atf7ip UTSW 6 136559816 missense probably damaging 1.00
R0045:Atf7ip UTSW 6 136559816 missense probably damaging 1.00
R0325:Atf7ip UTSW 6 136560989 missense possibly damaging 0.86
R0331:Atf7ip UTSW 6 136561163 missense possibly damaging 0.94
R0415:Atf7ip UTSW 6 136560012 missense possibly damaging 0.92
R0490:Atf7ip UTSW 6 136609192 unclassified probably benign
R0526:Atf7ip UTSW 6 136559805 missense probably damaging 1.00
R1503:Atf7ip UTSW 6 136606867 missense probably damaging 0.96
R1663:Atf7ip UTSW 6 136603324 missense possibly damaging 0.93
R1793:Atf7ip UTSW 6 136609219 unclassified probably benign
R1822:Atf7ip UTSW 6 136587260 missense probably benign 0.11
R1873:Atf7ip UTSW 6 136559888 missense probably damaging 1.00
R1937:Atf7ip UTSW 6 136560780 missense probably benign 0.41
R2059:Atf7ip UTSW 6 136609348 unclassified probably benign
R2134:Atf7ip UTSW 6 136605487 missense possibly damaging 0.80
R2679:Atf7ip UTSW 6 136566651 missense possibly damaging 0.62
R3430:Atf7ip UTSW 6 136575324 unclassified probably benign
R3755:Atf7ip UTSW 6 136560817 missense probably benign 0.01
R3756:Atf7ip UTSW 6 136560817 missense probably benign 0.01
R3890:Atf7ip UTSW 6 136587045 missense possibly damaging 0.48
R4190:Atf7ip UTSW 6 136587501 missense probably damaging 1.00
R4494:Atf7ip UTSW 6 136563749 splice site probably null
R4588:Atf7ip UTSW 6 136599694 missense probably benign
R4618:Atf7ip UTSW 6 136565106 missense probably damaging 1.00
R4705:Atf7ip UTSW 6 136561194 missense probably damaging 1.00
R4838:Atf7ip UTSW 6 136596491 missense probably benign 0.06
R4922:Atf7ip UTSW 6 136560041 missense possibly damaging 0.91
R4956:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R4957:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R4958:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R5000:Atf7ip UTSW 6 136582428 missense probably damaging 1.00
R5001:Atf7ip UTSW 6 136561388 missense probably damaging 0.99
R5075:Atf7ip UTSW 6 136560234 missense probably benign
R5279:Atf7ip UTSW 6 136603379 nonsense probably null
R5445:Atf7ip UTSW 6 136587257 missense probably damaging 1.00
R5844:Atf7ip UTSW 6 136606814 missense probably damaging 1.00
R5850:Atf7ip UTSW 6 136566787 critical splice donor site probably null
R5891:Atf7ip UTSW 6 136559977 missense possibly damaging 0.64
R5987:Atf7ip UTSW 6 136571502 missense probably damaging 1.00
R6168:Atf7ip UTSW 6 136559819 missense probably damaging 1.00
R6726:Atf7ip UTSW 6 136582391 missense probably damaging 1.00
R6924:Atf7ip UTSW 6 136559757 splice site probably null
R7075:Atf7ip UTSW 6 136596515 critical splice donor site probably null
R7308:Atf7ip UTSW 6 136565089 missense probably benign 0.01
R7365:Atf7ip UTSW 6 136560710 missense probably benign
R7556:Atf7ip UTSW 6 136561241 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGTCCAGGCAAGAGTGAAGAC -3'
(R):5'- ACTGAGTTCATCCTCGGTGG -3'

Sequencing Primer
(F):5'- GTGAAGACGACGAACACTTAGACC -3'
(R):5'- GGGTGCGAGTTTTTCCAAAATC -3'
Posted On2018-10-18