Incidental Mutation 'R6880:Olfr700'
ID536617
Institutional Source Beutler Lab
Gene Symbol Olfr700
Ensembl Gene ENSMUSG00000094493
Gene Nameolfactory receptor 700
SynonymsGA_x6K02T2PBJ9-9184187-9183237, MOR283-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6880 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106805395-106808834 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106805812 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 217 (S217T)
Ref Sequence ENSEMBL: ENSMUSP00000150320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079936] [ENSMUST00000214840]
Predicted Effect probably damaging
Transcript: ENSMUST00000079936
AA Change: S217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078855
Gene: ENSMUSG00000094493
AA Change: S217T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.6e-5 PFAM
Pfam:7tm_1 41 290 3.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214840
AA Change: S217T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,069,705 probably null Het
Aff3 T C 1: 38,535,162 H206R probably damaging Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Alg5 A G 3: 54,738,843 E43G probably damaging Het
Ankrd36 T C 11: 5,628,748 L4P probably damaging Het
Ano1 T C 7: 144,644,742 Y345C probably benign Het
Atf7ip A G 6: 136,561,040 I432V probably damaging Het
B230307C23Rik T C 16: 97,997,427 probably benign Het
Baz2b T A 2: 59,912,939 N1563Y probably damaging Het
Bhlha15 A T 5: 144,191,633 T188S probably damaging Het
Cbr3 T C 16: 93,690,538 V203A probably benign Het
Cpsf1 T C 15: 76,602,539 T266A probably benign Het
Dnah7c T C 1: 46,527,671 Y681H probably damaging Het
Dock2 C T 11: 34,688,452 probably null Het
Dsc1 T A 18: 20,088,372 D682V probably damaging Het
Fkbp15 A T 4: 62,336,495 I256N possibly damaging Het
Foxd1 A C 13: 98,354,717 D33A unknown Het
Gid4 T A 11: 60,436,435 F149I probably damaging Het
Hmcn2 G T 2: 31,343,056 V206L probably damaging Het
Ighg2b T C 12: 113,307,106 I135V Het
Ighv1-24 T C 12: 114,773,043 Y79C possibly damaging Het
Impg1 T A 9: 80,404,800 D167V probably damaging Het
Jakmip1 T C 5: 37,105,623 S372P possibly damaging Het
Kcnb1 T C 2: 167,105,807 T374A probably damaging Het
Lrrn4 A G 2: 132,872,112 S305P probably damaging Het
Ltbp1 C T 17: 75,321,049 T1179I possibly damaging Het
Mab21l2 A G 3: 86,547,156 I179T possibly damaging Het
Myo5b A T 18: 74,722,430 H1230L probably benign Het
Myocos T C 1: 162,657,033 probably null Het
Nipa2 T C 7: 55,933,251 T249A probably damaging Het
Oas1a C A 5: 120,901,940 R196L probably damaging Het
Olfr228 A G 2: 86,483,725 F6L probably benign Het
Olfr235 A G 19: 12,268,610 I127V probably benign Het
Phxr2 G A 10: 99,126,084 probably benign Het
Pigq A G 17: 25,934,828 L85P probably damaging Het
Pla2g4a T A 1: 149,851,451 D518V possibly damaging Het
Pm20d1 A G 1: 131,804,101 K294E probably benign Het
Polr3d C A 14: 70,440,015 R307L probably benign Het
Pou5f2 T C 13: 78,025,494 L185P possibly damaging Het
Prex2 A T 1: 11,132,384 N506Y probably damaging Het
Proser1 T A 3: 53,477,839 S381T probably benign Het
Prpf4b T C 13: 34,894,453 V682A possibly damaging Het
Prr14l A T 5: 32,830,867 L428Q probably benign Het
Prss23 A G 7: 89,510,825 V12A probably benign Het
Qk T C 17: 10,215,447 D321G probably benign Het
Rab11fip5 A G 6: 85,348,845 L193P probably damaging Het
Retreg1 T G 15: 25,971,739 L245R probably damaging Het
Rfc1 T C 5: 65,277,386 N679S probably benign Het
Rpl4 C T 9: 64,177,053 A220V probably damaging Het
Rxra G A 2: 27,748,656 E224K possibly damaging Het
Slc26a7 A G 4: 14,516,159 C557R possibly damaging Het
Sncaip A G 18: 52,869,064 K219R probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sphkap A G 1: 83,257,257 V1616A probably damaging Het
Sulf1 T C 1: 12,842,755 C738R probably damaging Het
Suz12 T A 11: 80,002,172 C38* probably null Het
Ttn T C 2: 76,720,498 T23190A probably damaging Het
Twnk A G 19: 45,007,416 D96G probably benign Het
Vcan T A 13: 89,712,381 N289I probably damaging Het
Vmn2r120 A T 17: 57,509,187 S723T probably damaging Het
Vmn2r97 A T 17: 18,914,508 I63F probably benign Het
Washc5 T C 15: 59,350,172 N125S probably benign Het
Zfp865 A G 7: 5,030,549 Y511C probably damaging Het
Other mutations in Olfr700
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Olfr700 APN 7 106806435 missense probably benign 0.03
IGL01474:Olfr700 APN 7 106805940 missense probably benign 0.23
IGL01720:Olfr700 APN 7 106806209 missense probably damaging 0.99
R0501:Olfr700 UTSW 7 106805811 missense probably damaging 1.00
R2061:Olfr700 UTSW 7 106805768 missense probably benign 0.00
R2511:Olfr700 UTSW 7 106805961 missense probably damaging 1.00
R2876:Olfr700 UTSW 7 106805997 missense probably benign 0.00
R3816:Olfr700 UTSW 7 106805820 missense probably damaging 1.00
R3910:Olfr700 UTSW 7 106805865 missense probably damaging 1.00
R3911:Olfr700 UTSW 7 106805865 missense probably damaging 1.00
R3912:Olfr700 UTSW 7 106805865 missense probably damaging 1.00
R4855:Olfr700 UTSW 7 106806256 missense probably benign 0.01
R4864:Olfr700 UTSW 7 106805964 missense probably damaging 1.00
R5101:Olfr700 UTSW 7 106806213 missense possibly damaging 0.53
R5335:Olfr700 UTSW 7 106805734 missense probably damaging 1.00
R6217:Olfr700 UTSW 7 106806072 missense probably damaging 1.00
R7522:Olfr700 UTSW 7 106805787 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAGCTGGGGTGACAATTG -3'
(R):5'- ATCATGGACCCTGGCATCTC -3'

Sequencing Primer
(F):5'- CTGGGGTGACAATTGTGTAGAAAAC -3'
(R):5'- CTCTGAGTGCAGTAGGATATACC -3'
Posted On2018-10-18