Incidental Mutation 'R6880:Rpl4'
ID536619
Institutional Source Beutler Lab
Gene Symbol Rpl4
Ensembl Gene ENSMUSG00000032399
Gene Nameribosomal protein L4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R6880 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location64173375-64178666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64177053 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 220 (A220V)
Ref Sequence ENSEMBL: ENSMUSP00000034966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034965] [ENSMUST00000034966] [ENSMUST00000122091] [ENSMUST00000130127] [ENSMUST00000176299] [ENSMUST00000176378] [ENSMUST00000176794] [ENSMUST00000177045]
Predicted Effect probably benign
Transcript: ENSMUST00000034965
SMART Domains Protein: ENSMUSP00000034965
Gene: ENSMUSG00000032398

DomainStartEndE-ValueType
Pfam:SNAPc19 7 101 5.4e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034966
AA Change: A220V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034966
Gene: ENSMUSG00000032399
AA Change: A220V

DomainStartEndE-ValueType
Pfam:Ribosomal_L4 22 263 9.7e-47 PFAM
Pfam:Ribos_L4_asso_C 275 349 4e-34 PFAM
low complexity region 352 367 N/A INTRINSIC
low complexity region 375 419 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122091
SMART Domains Protein: ENSMUSP00000112790
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 38 589 6e-206 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124301
SMART Domains Protein: ENSMUSP00000134966
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 3e-31 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000130127
SMART Domains Protein: ENSMUSP00000116187
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 72 154 8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176299
SMART Domains Protein: ENSMUSP00000135585
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 1 471 2.9e-192 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176378
SMART Domains Protein: ENSMUSP00000134782
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 1e-31 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176794
SMART Domains Protein: ENSMUSP00000134850
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 38 257 8e-67 PFAM
Pfam:DUF2352 254 568 4.4e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177045
SMART Domains Protein: ENSMUSP00000135328
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 19 303 2.2e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L4E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,069,705 probably null Het
Aff3 T C 1: 38,535,162 H206R probably damaging Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Alg5 A G 3: 54,738,843 E43G probably damaging Het
Ankrd36 T C 11: 5,628,748 L4P probably damaging Het
Ano1 T C 7: 144,644,742 Y345C probably benign Het
Atf7ip A G 6: 136,561,040 I432V probably damaging Het
B230307C23Rik T C 16: 97,997,427 probably benign Het
Baz2b T A 2: 59,912,939 N1563Y probably damaging Het
Bhlha15 A T 5: 144,191,633 T188S probably damaging Het
Cbr3 T C 16: 93,690,538 V203A probably benign Het
Cpsf1 T C 15: 76,602,539 T266A probably benign Het
Dnah7c T C 1: 46,527,671 Y681H probably damaging Het
Dock2 C T 11: 34,688,452 probably null Het
Dsc1 T A 18: 20,088,372 D682V probably damaging Het
Fkbp15 A T 4: 62,336,495 I256N possibly damaging Het
Foxd1 A C 13: 98,354,717 D33A unknown Het
Gid4 T A 11: 60,436,435 F149I probably damaging Het
Hmcn2 G T 2: 31,343,056 V206L probably damaging Het
Ighg2b T C 12: 113,307,106 I135V Het
Ighv1-24 T C 12: 114,773,043 Y79C possibly damaging Het
Impg1 T A 9: 80,404,800 D167V probably damaging Het
Jakmip1 T C 5: 37,105,623 S372P possibly damaging Het
Kcnb1 T C 2: 167,105,807 T374A probably damaging Het
Lrrn4 A G 2: 132,872,112 S305P probably damaging Het
Ltbp1 C T 17: 75,321,049 T1179I possibly damaging Het
Mab21l2 A G 3: 86,547,156 I179T possibly damaging Het
Myo5b A T 18: 74,722,430 H1230L probably benign Het
Myocos T C 1: 162,657,033 probably null Het
Nipa2 T C 7: 55,933,251 T249A probably damaging Het
Oas1a C A 5: 120,901,940 R196L probably damaging Het
Olfr228 A G 2: 86,483,725 F6L probably benign Het
Olfr235 A G 19: 12,268,610 I127V probably benign Het
Olfr700 A T 7: 106,805,812 S217T probably damaging Het
Phxr2 G A 10: 99,126,084 probably benign Het
Pigq A G 17: 25,934,828 L85P probably damaging Het
Pla2g4a T A 1: 149,851,451 D518V possibly damaging Het
Pm20d1 A G 1: 131,804,101 K294E probably benign Het
Polr3d C A 14: 70,440,015 R307L probably benign Het
Pou5f2 T C 13: 78,025,494 L185P possibly damaging Het
Prex2 A T 1: 11,132,384 N506Y probably damaging Het
Proser1 T A 3: 53,477,839 S381T probably benign Het
Prpf4b T C 13: 34,894,453 V682A possibly damaging Het
Prr14l A T 5: 32,830,867 L428Q probably benign Het
Prss23 A G 7: 89,510,825 V12A probably benign Het
Qk T C 17: 10,215,447 D321G probably benign Het
Rab11fip5 A G 6: 85,348,845 L193P probably damaging Het
Retreg1 T G 15: 25,971,739 L245R probably damaging Het
Rfc1 T C 5: 65,277,386 N679S probably benign Het
Rxra G A 2: 27,748,656 E224K possibly damaging Het
Slc26a7 A G 4: 14,516,159 C557R possibly damaging Het
Sncaip A G 18: 52,869,064 K219R probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sphkap A G 1: 83,257,257 V1616A probably damaging Het
Sulf1 T C 1: 12,842,755 C738R probably damaging Het
Suz12 T A 11: 80,002,172 C38* probably null Het
Ttn T C 2: 76,720,498 T23190A probably damaging Het
Twnk A G 19: 45,007,416 D96G probably benign Het
Vcan T A 13: 89,712,381 N289I probably damaging Het
Vmn2r120 A T 17: 57,509,187 S723T probably damaging Het
Vmn2r97 A T 17: 18,914,508 I63F probably benign Het
Washc5 T C 15: 59,350,172 N125S probably benign Het
Zfp865 A G 7: 5,030,549 Y511C probably damaging Het
Other mutations in Rpl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Rpl4 APN 9 64174939 missense probably damaging 1.00
IGL02142:Rpl4 APN 9 64176206 missense possibly damaging 0.86
IGL02746:Rpl4 APN 9 64175650 missense probably benign 0.00
IGL03084:Rpl4 APN 9 64178317 unclassified probably benign
IGL03332:Rpl4 APN 9 64176088 unclassified probably benign
R2320:Rpl4 UTSW 9 64175599 missense probably damaging 1.00
R4990:Rpl4 UTSW 9 64174885 missense probably benign 0.15
R7734:Rpl4 UTSW 9 64177379 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TTGCTTTGCCTGCTGAGAC -3'
(R):5'- GCTACCTAGGGCACTTAGAAGC -3'

Sequencing Primer
(F):5'- GCCTGCTGAGACAGTTTTTC -3'
(R):5'- TTAGAAGCTCAAGCCATCATGG -3'
Posted On2018-10-18