Incidental Mutation 'R6880:Sorbs1'
ID536644
Institutional Source Beutler Lab
Gene Symbol Sorbs1
Ensembl Gene ENSMUSG00000025006
Gene Namesorbin and SH3 domain containing 1
Synonyms9530001P15Rik, 2310065E01Rik, Ponsin, Sh3d5, CAP, c-Cbl-associated protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R6880 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40294753-40513779 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 40376800 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 180 (R180G)
Ref Sequence ENSEMBL: ENSMUSP00000153313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224233] [ENSMUST00000224247] [ENSMUST00000224583] [ENSMUST00000224667] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000225786] [ENSMUST00000226047]
Predicted Effect probably benign
Transcript: ENSMUST00000099466
SMART Domains Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 203 249 1.07e-26 SMART
SH3 502 557 2.72e-18 SMART
SH3 576 633 9.32e-17 SMART
low complexity region 647 660 N/A INTRINSIC
SH3 682 739 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099467
AA Change: R180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006
AA Change: R180G

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 192 213 N/A INTRINSIC
Sorb 327 373 1.24e-22 SMART
coiled coil region 558 584 N/A INTRINSIC
SH3 700 755 2.72e-18 SMART
SH3 774 831 9.32e-17 SMART
low complexity region 845 858 N/A INTRINSIC
SH3 880 937 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165212
SMART Domains Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 193 239 1.07e-26 SMART
SH3 486 541 2.72e-18 SMART
SH3 560 617 9.32e-17 SMART
low complexity region 631 644 N/A INTRINSIC
SH3 666 723 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165469
SMART Domains Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006

DomainStartEndE-ValueType
low complexity region 75 93 N/A INTRINSIC
Sorb 233 279 1.07e-26 SMART
SH3 476 531 2.72e-18 SMART
SH3 550 607 9.32e-17 SMART
low complexity region 621 634 N/A INTRINSIC
SH3 656 713 3.7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224233
Predicted Effect probably benign
Transcript: ENSMUST00000224247
Predicted Effect probably benign
Transcript: ENSMUST00000224583
Predicted Effect probably benign
Transcript: ENSMUST00000224667
Predicted Effect probably benign
Transcript: ENSMUST00000225148
Predicted Effect probably benign
Transcript: ENSMUST00000225153
AA Change: R180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225786
Predicted Effect probably benign
Transcript: ENSMUST00000226047
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,069,705 probably null Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Aff3 T C 1: 38,535,162 H206R probably damaging Het
Alg5 A G 3: 54,738,843 E43G probably damaging Het
Ankrd36 T C 11: 5,628,748 L4P probably damaging Het
Ano1 T C 7: 144,644,742 Y345C probably benign Het
Atf7ip A G 6: 136,561,040 I432V probably damaging Het
B230307C23Rik T C 16: 97,997,427 probably benign Het
Baz2b T A 2: 59,912,939 N1563Y probably damaging Het
Bhlha15 A T 5: 144,191,633 T188S probably damaging Het
Cbr3 T C 16: 93,690,538 V203A probably benign Het
Cpsf1 T C 15: 76,602,539 T266A probably benign Het
Dnah7c T C 1: 46,527,671 Y681H probably damaging Het
Dock2 C T 11: 34,688,452 probably null Het
Dsc1 T A 18: 20,088,372 D682V probably damaging Het
Fkbp15 A T 4: 62,336,495 I256N possibly damaging Het
Foxd1 A C 13: 98,354,717 D33A unknown Het
Gid4 T A 11: 60,436,435 F149I probably damaging Het
Hmcn2 G T 2: 31,343,056 V206L probably damaging Het
Ighg2b T C 12: 113,307,106 I135V Het
Ighv1-24 T C 12: 114,773,043 Y79C possibly damaging Het
Impg1 T A 9: 80,404,800 D167V probably damaging Het
Jakmip1 T C 5: 37,105,623 S372P possibly damaging Het
Kcnb1 T C 2: 167,105,807 T374A probably damaging Het
Lrrn4 A G 2: 132,872,112 S305P probably damaging Het
Ltbp1 C T 17: 75,321,049 T1179I possibly damaging Het
Mab21l2 A G 3: 86,547,156 I179T possibly damaging Het
Myo5b A T 18: 74,722,430 H1230L probably benign Het
Myocos T C 1: 162,657,033 probably null Het
Nipa2 T C 7: 55,933,251 T249A probably damaging Het
Oas1a C A 5: 120,901,940 R196L probably damaging Het
Olfr228 A G 2: 86,483,725 F6L probably benign Het
Olfr235 A G 19: 12,268,610 I127V probably benign Het
Olfr700 A T 7: 106,805,812 S217T probably damaging Het
Phxr2 G A 10: 99,126,084 probably benign Het
Pigq A G 17: 25,934,828 L85P probably damaging Het
Pla2g4a T A 1: 149,851,451 D518V possibly damaging Het
Pm20d1 A G 1: 131,804,101 K294E probably benign Het
Polr3d C A 14: 70,440,015 R307L probably benign Het
Pou5f2 T C 13: 78,025,494 L185P possibly damaging Het
Prex2 A T 1: 11,132,384 N506Y probably damaging Het
Proser1 T A 3: 53,477,839 S381T probably benign Het
Prpf4b T C 13: 34,894,453 V682A possibly damaging Het
Prr14l A T 5: 32,830,867 L428Q probably benign Het
Prss23 A G 7: 89,510,825 V12A probably benign Het
Qk T C 17: 10,215,447 D321G probably benign Het
Rab11fip5 A G 6: 85,348,845 L193P probably damaging Het
Retreg1 T G 15: 25,971,739 L245R probably damaging Het
Rfc1 T C 5: 65,277,386 N679S probably benign Het
Rpl4 C T 9: 64,177,053 A220V probably damaging Het
Rxra G A 2: 27,748,656 E224K possibly damaging Het
Slc26a7 A G 4: 14,516,159 C557R possibly damaging Het
Sncaip A G 18: 52,869,064 K219R probably damaging Het
Sphkap A G 1: 83,257,257 V1616A probably damaging Het
Sulf1 T C 1: 12,842,755 C738R probably damaging Het
Suz12 T A 11: 80,002,172 C38* probably null Het
Ttn T C 2: 76,720,498 T23190A probably damaging Het
Twnk A G 19: 45,007,416 D96G probably benign Het
Vcan T A 13: 89,712,381 N289I probably damaging Het
Vmn2r120 A T 17: 57,509,187 S723T probably damaging Het
Vmn2r97 A T 17: 18,914,508 I63F probably benign Het
Washc5 T C 15: 59,350,172 N125S probably benign Het
Zfp865 A G 7: 5,030,549 Y511C probably damaging Het
Other mutations in Sorbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sorbs1 APN 19 40318029 missense probably damaging 1.00
IGL00776:Sorbs1 APN 19 40344351 splice site probably null
IGL00788:Sorbs1 APN 19 40337043 splice site probably benign
IGL00943:Sorbs1 APN 19 40295040 utr 3 prime probably benign
IGL01525:Sorbs1 APN 19 40349978 missense probably damaging 1.00
IGL01530:Sorbs1 APN 19 40376647 missense probably benign 0.01
IGL01951:Sorbs1 APN 19 40318016 splice site probably benign
IGL02159:Sorbs1 APN 19 40327596 missense probably damaging 0.96
IGL02252:Sorbs1 APN 19 40314397 missense probably damaging 1.00
IGL02613:Sorbs1 APN 19 40327547 missense probably damaging 1.00
IGL02643:Sorbs1 APN 19 40365133 missense possibly damaging 0.65
IGL02668:Sorbs1 APN 19 40314681 missense probably damaging 1.00
IGL02738:Sorbs1 APN 19 40376904 missense probably damaging 0.97
IGL02965:Sorbs1 APN 19 40376743 missense probably benign 0.01
IGL03083:Sorbs1 APN 19 40314376 missense probably damaging 1.00
IGL03173:Sorbs1 APN 19 40363262 missense probably damaging 1.00
IGL03286:Sorbs1 APN 19 40344414 missense probably damaging 0.99
IGL03292:Sorbs1 APN 19 40373565 missense possibly damaging 0.79
R0016:Sorbs1 UTSW 19 40314738 splice site probably benign
R0016:Sorbs1 UTSW 19 40314738 splice site probably benign
R0306:Sorbs1 UTSW 19 40344411 missense possibly damaging 0.94
R0526:Sorbs1 UTSW 19 40349948 missense probably damaging 1.00
R0551:Sorbs1 UTSW 19 40311816 missense probably damaging 1.00
R0688:Sorbs1 UTSW 19 40363262 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1891:Sorbs1 UTSW 19 40393460 missense probably damaging 0.99
R2066:Sorbs1 UTSW 19 40365028 unclassified probably null
R2148:Sorbs1 UTSW 19 40376824 missense possibly damaging 0.94
R2214:Sorbs1 UTSW 19 40296631 missense probably damaging 1.00
R2410:Sorbs1 UTSW 19 40373515 missense probably damaging 0.99
R2940:Sorbs1 UTSW 19 40373571 missense probably damaging 1.00
R3847:Sorbs1 UTSW 19 40314443 missense probably damaging 0.97
R4405:Sorbs1 UTSW 19 40395745 missense probably benign 0.03
R4544:Sorbs1 UTSW 19 40311850 missense probably damaging 0.99
R4618:Sorbs1 UTSW 19 40373518 missense probably damaging 0.99
R4731:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4732:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4733:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4860:Sorbs1 UTSW 19 40337005 missense probably benign 0.44
R4860:Sorbs1 UTSW 19 40337005 missense probably benign 0.44
R4907:Sorbs1 UTSW 19 40340047 nonsense probably null
R4912:Sorbs1 UTSW 19 40311727 missense probably damaging 1.00
R5229:Sorbs1 UTSW 19 40340707 missense probably damaging 1.00
R5285:Sorbs1 UTSW 19 40321890 missense probably damaging 1.00
R5416:Sorbs1 UTSW 19 40376989 missense probably benign 0.06
R5706:Sorbs1 UTSW 19 40376881 missense probably benign
R5871:Sorbs1 UTSW 19 40398583 missense probably damaging 1.00
R5936:Sorbs1 UTSW 19 40324772 missense probably damaging 0.96
R6073:Sorbs1 UTSW 19 40314657 missense probably damaging 1.00
R6324:Sorbs1 UTSW 19 40321819 missense probably damaging 0.99
R6343:Sorbs1 UTSW 19 40376982 critical splice donor site probably null
R6561:Sorbs1 UTSW 19 40326052 missense probably benign
R6646:Sorbs1 UTSW 19 40325549 missense probably damaging 1.00
R6768:Sorbs1 UTSW 19 40327547 missense probably damaging 1.00
R6849:Sorbs1 UTSW 19 40376800 missense probably benign
R6850:Sorbs1 UTSW 19 40376800 missense probably benign
R6878:Sorbs1 UTSW 19 40376800 missense probably benign
R6879:Sorbs1 UTSW 19 40376800 missense probably benign
R6908:Sorbs1 UTSW 19 40352332 missense probably damaging 1.00
R6980:Sorbs1 UTSW 19 40327616 nonsense probably null
R7040:Sorbs1 UTSW 19 40376800 missense probably benign
R7041:Sorbs1 UTSW 19 40376800 missense probably benign
R7110:Sorbs1 UTSW 19 40376800 missense probably benign
R7122:Sorbs1 UTSW 19 40376800 missense probably benign
R7170:Sorbs1 UTSW 19 40326129 nonsense probably null
R7180:Sorbs1 UTSW 19 40376800 missense probably benign
R7185:Sorbs1 UTSW 19 40376800 missense probably benign
R7187:Sorbs1 UTSW 19 40376800 missense probably benign
R7254:Sorbs1 UTSW 19 40376800 missense probably benign
R7255:Sorbs1 UTSW 19 40376800 missense probably benign
R7401:Sorbs1 UTSW 19 40376800 missense probably benign
R7595:Sorbs1 UTSW 19 40314653 missense probably damaging 0.99
R7819:Sorbs1 UTSW 19 40376800 missense probably benign
R7876:Sorbs1 UTSW 19 40296588 missense probably damaging 1.00
R7894:Sorbs1 UTSW 19 40327576 missense probably benign 0.02
R7959:Sorbs1 UTSW 19 40296588 missense probably damaging 1.00
R7977:Sorbs1 UTSW 19 40327576 missense probably benign 0.02
R8031:Sorbs1 UTSW 19 40326489 missense probably benign 0.17
Z1177:Sorbs1 UTSW 19 40326895 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGCAGACATTCAGGGTAGC -3'
(R):5'- AGCCCCGTCTGAGGTAATAG -3'

Sequencing Primer
(F):5'- ACATTCAGGGTAGCCGTGG -3'
(R):5'- CCCCGTCTGAGGTAATAGTTGTTC -3'
Posted On2018-10-18