Incidental Mutation 'R6881:Clrn2'
ID536659
Institutional Source Beutler Lab
Gene Symbol Clrn2
Ensembl Gene ENSMUSG00000049530
Gene Nameclarin 2
SynonymsEG624224
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6881 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location45453751-45464149 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 45453822 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 4 (W4*)
Ref Sequence ENSEMBL: ENSMUSP00000058204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015950] [ENSMUST00000053250] [ENSMUST00000118097] [ENSMUST00000120867] [ENSMUST00000127562] [ENSMUST00000154962] [ENSMUST00000197946] [ENSMUST00000198258]
Predicted Effect probably benign
Transcript: ENSMUST00000015950
SMART Domains Protein: ENSMUSP00000015950
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
Pfam:adh_short 8 195 5.4e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000053250
AA Change: W4*
SMART Domains Protein: ENSMUSP00000058204
Gene: ENSMUSG00000049530
AA Change: W4*

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 102 124 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
low complexity region 176 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118097
SMART Domains Protein: ENSMUSP00000113958
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120867
SMART Domains Protein: ENSMUSP00000113203
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127562
SMART Domains Protein: ENSMUSP00000115453
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 137 7e-67 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154962
SMART Domains Protein: ENSMUSP00000122081
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 159 7e-72 PDB
SCOP:d1hdr__ 6 159 6e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197946
SMART Domains Protein: ENSMUSP00000143584
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 213 1e-125 PDB
SCOP:d1hdr__ 6 162 2e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198258
SMART Domains Protein: ENSMUSP00000143741
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 139 8e-86 PDB
SCOP:d1hdr__ 14 139 6e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the clarin family of genes. The clarins appear to belong to a large superfamily of small integral membrane glycoproteins with four transmembrane domains. The exact function of this gene is unknown. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009C09Rik C A 15: 82,259,585 H3N possibly damaging Het
4931406C07Rik A C 9: 15,290,765 C187G possibly damaging Het
Abhd16a C T 17: 35,096,601 T208I probably benign Het
Ahcyl1 A T 3: 107,668,109 H425Q probably damaging Het
Ankrd22 T A 19: 34,149,382 N16I probably damaging Het
Cc2d2b A G 19: 40,825,039 E1321G probably damaging Het
Ccdc7b A G 8: 129,072,547 E35G probably damaging Het
Chsy3 A G 18: 59,179,408 I318V probably damaging Het
Cmip T C 8: 117,436,595 I355T possibly damaging Het
Cmya5 C T 13: 93,090,292 V2763M probably damaging Het
Cnnm2 T C 19: 46,877,219 S749P probably damaging Het
Cyp1a1 G T 9: 57,700,719 R210L possibly damaging Het
Dmxl1 G A 18: 49,935,305 S2715N probably benign Het
Dync1h1 T C 12: 110,624,561 L1021P probably damaging Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Galnt11 G T 5: 25,250,099 K144N possibly damaging Het
Gm45861 A G 8: 27,535,251 probably null Het
Kcnk18 T A 19: 59,219,958 D75E probably benign Het
Kcnk2 C T 1: 189,209,990 V346M probably benign Het
Klhl33 T A 14: 50,891,472 M767L probably benign Het
Knl1 T C 2: 119,095,184 I1898T possibly damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lamp3 T C 16: 19,699,618 T290A probably benign Het
Larp1 T A 11: 58,050,023 D658E probably damaging Het
Macf1 T A 4: 123,432,453 I3521F probably damaging Het
Med12l T C 3: 59,267,165 S1835P probably benign Het
Mef2c C A 13: 83,592,942 N73K probably damaging Het
Mtmr3 T C 11: 4,489,725 S572G probably benign Het
Neto2 A T 8: 85,640,556 S520T probably damaging Het
Olfr1215 A T 2: 89,001,937 M117K probably damaging Het
Olfr1330 A G 4: 118,893,107 N8S probably damaging Het
Olfr99 A G 17: 37,280,309 L37S probably benign Het
P3h2 G A 16: 25,992,745 R243C probably damaging Het
Papd5 T C 8: 88,250,788 V363A possibly damaging Het
Pld1 T C 3: 28,078,414 S584P possibly damaging Het
Prkcz T C 4: 155,269,056 N278S possibly damaging Het
Radil A G 5: 142,486,917 S913P probably benign Het
Retreg2 A C 1: 75,146,439 Q337P probably damaging Het
Sh3gl3 A G 7: 82,306,970 E305G possibly damaging Het
Shank1 G T 7: 44,351,793 D979Y unknown Het
Slc35a5 A T 16: 45,144,080 N263K possibly damaging Het
Slc4a7 A T 14: 14,737,452 M127L probably benign Het
Slc8a2 G A 7: 16,157,357 G774E probably damaging Het
Snap91 A G 9: 86,773,593 S847P possibly damaging Het
Stoml1 T C 9: 58,260,894 L296P probably damaging Het
Tap1 G T 17: 34,188,034 G52V probably damaging Het
Tnfrsf11b T C 15: 54,254,143 R239G probably benign Het
Ttn T C 2: 76,706,502 Y34993C probably damaging Het
Uchl1 T C 5: 66,683,722 F165L probably damaging Het
Xrcc1 C T 7: 24,547,351 Q15* probably null Het
Zkscan7 C G 9: 122,888,701 Q54E possibly damaging Het
Other mutations in Clrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Clrn2 APN 5 45463969 utr 3 prime probably benign
IGL01538:Clrn2 APN 5 45460066 missense probably damaging 1.00
IGL01585:Clrn2 APN 5 45460158 missense probably benign 0.00
IGL01783:Clrn2 APN 5 45460161 missense probably benign
IGL02479:Clrn2 APN 5 45463912 missense probably benign 0.03
IGL02709:Clrn2 APN 5 45460153 missense probably damaging 1.00
IGL03220:Clrn2 APN 5 45463728 missense probably damaging 1.00
R1443:Clrn2 UTSW 5 45460111 missense probably damaging 1.00
R1942:Clrn2 UTSW 5 45453995 missense probably benign 0.26
R2258:Clrn2 UTSW 5 45453962 missense probably benign 0.03
R4806:Clrn2 UTSW 5 45454004 missense probably damaging 1.00
R5943:Clrn2 UTSW 5 45463719 missense probably benign 0.01
R5987:Clrn2 UTSW 5 45454027 missense probably benign 0.09
R6029:Clrn2 UTSW 5 45460186 missense probably damaging 1.00
R6371:Clrn2 UTSW 5 45460198 missense possibly damaging 0.62
R6474:Clrn2 UTSW 5 45463732 missense probably benign 0.04
R6939:Clrn2 UTSW 5 45453754 unclassified probably benign
R7156:Clrn2 UTSW 5 45453916 missense probably damaging 0.99
R7186:Clrn2 UTSW 5 45453773 unclassified probably benign
R7392:Clrn2 UTSW 5 45463909 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ATAGGGTTACTTCCTTGGGTAACAC -3'
(R):5'- GTCCCCGATGAATTTGACCAG -3'

Sequencing Primer
(F):5'- GGGTAACACACTCTGCTATATCAAG -3'
(R):5'- CCCGATGAATTTGACCAGTTCTGG -3'
Posted On2018-10-18