Incidental Mutation 'R6881:Tnfrsf11b'
ID536684
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11b
Ensembl Gene ENSMUSG00000063727
Gene Nametumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)
SynonymsOpg, OCIF, OPG, TR1, osteoclastogenesis inhibitory factor
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_008764.3; MGI:109587

Is this an essential gene? Possibly essential (E-score: 0.556) question?
Stock #R6881 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location54250619-54278484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54254143 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 239 (R239G)
Ref Sequence ENSEMBL: ENSMUSP00000078705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079772]
PDB Structure
Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000079772
AA Change: R239G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000078705
Gene: ENSMUSG00000063727
AA Change: R239G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 24 62 1.04e-2 SMART
TNFR 65 105 1.5e-8 SMART
TNFR 107 142 2.19e-10 SMART
TNFR 145 185 7.63e-1 SMART
DEATH 270 365 1.01e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (53/54)
MGI Phenotype Strain: 2181227
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have abnormal bone remodeling that results in severe osteoperosis with increased risk of fractures and growth retardation. Progressive hearing loss also results due to abnormal remodeling of the otic capsule. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009C09Rik C A 15: 82,259,585 H3N possibly damaging Het
4931406C07Rik A C 9: 15,290,765 C187G possibly damaging Het
Abhd16a C T 17: 35,096,601 T208I probably benign Het
Ahcyl1 A T 3: 107,668,109 H425Q probably damaging Het
Ankrd22 T A 19: 34,149,382 N16I probably damaging Het
Cc2d2b A G 19: 40,825,039 E1321G probably damaging Het
Ccdc7b A G 8: 129,072,547 E35G probably damaging Het
Chsy3 A G 18: 59,179,408 I318V probably damaging Het
Clrn2 G A 5: 45,453,822 W4* probably null Het
Cmip T C 8: 117,436,595 I355T possibly damaging Het
Cmya5 C T 13: 93,090,292 V2763M probably damaging Het
Cnnm2 T C 19: 46,877,219 S749P probably damaging Het
Cyp1a1 G T 9: 57,700,719 R210L possibly damaging Het
Dmxl1 G A 18: 49,935,305 S2715N probably benign Het
Dync1h1 T C 12: 110,624,561 L1021P probably damaging Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Galnt11 G T 5: 25,250,099 K144N possibly damaging Het
Gm45861 A G 8: 27,535,251 probably null Het
Kcnk18 T A 19: 59,219,958 D75E probably benign Het
Kcnk2 C T 1: 189,209,990 V346M probably benign Het
Klhl33 T A 14: 50,891,472 M767L probably benign Het
Knl1 T C 2: 119,095,184 I1898T possibly damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lamp3 T C 16: 19,699,618 T290A probably benign Het
Larp1 T A 11: 58,050,023 D658E probably damaging Het
Macf1 T A 4: 123,432,453 I3521F probably damaging Het
Med12l T C 3: 59,267,165 S1835P probably benign Het
Mef2c C A 13: 83,592,942 N73K probably damaging Het
Mtmr3 T C 11: 4,489,725 S572G probably benign Het
Neto2 A T 8: 85,640,556 S520T probably damaging Het
Olfr1215 A T 2: 89,001,937 M117K probably damaging Het
Olfr1330 A G 4: 118,893,107 N8S probably damaging Het
Olfr99 A G 17: 37,280,309 L37S probably benign Het
P3h2 G A 16: 25,992,745 R243C probably damaging Het
Papd5 T C 8: 88,250,788 V363A possibly damaging Het
Pld1 T C 3: 28,078,414 S584P possibly damaging Het
Prkcz T C 4: 155,269,056 N278S possibly damaging Het
Radil A G 5: 142,486,917 S913P probably benign Het
Retreg2 A C 1: 75,146,439 Q337P probably damaging Het
Sh3gl3 A G 7: 82,306,970 E305G possibly damaging Het
Shank1 G T 7: 44,351,793 D979Y unknown Het
Slc35a5 A T 16: 45,144,080 N263K possibly damaging Het
Slc4a7 A T 14: 14,737,452 M127L probably benign Het
Slc8a2 G A 7: 16,157,357 G774E probably damaging Het
Snap91 A G 9: 86,773,593 S847P possibly damaging Het
Stoml1 T C 9: 58,260,894 L296P probably damaging Het
Tap1 G T 17: 34,188,034 G52V probably damaging Het
Ttn T C 2: 76,706,502 Y34993C probably damaging Het
Uchl1 T C 5: 66,683,722 F165L probably damaging Het
Xrcc1 C T 7: 24,547,351 Q15* probably null Het
Zkscan7 C G 9: 122,888,701 Q54E possibly damaging Het
Other mutations in Tnfrsf11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnfrsf11b APN 15 54259842 missense probably damaging 1.00
IGL00770:Tnfrsf11b APN 15 54254072 missense probably benign 0.16
IGL00774:Tnfrsf11b APN 15 54254072 missense probably benign 0.16
IGL02355:Tnfrsf11b APN 15 54252382 missense probably damaging 0.96
IGL02362:Tnfrsf11b APN 15 54252382 missense probably damaging 0.96
IGL02711:Tnfrsf11b APN 15 54256136 missense probably benign 0.01
IGL02870:Tnfrsf11b APN 15 54256027 missense probably benign 0.05
IGL03219:Tnfrsf11b APN 15 54254178 nonsense probably null
P0012:Tnfrsf11b UTSW 15 54259798 splice site probably benign
R1550:Tnfrsf11b UTSW 15 54254058 missense possibly damaging 0.94
R1813:Tnfrsf11b UTSW 15 54256097 nonsense probably null
R3840:Tnfrsf11b UTSW 15 54252082 missense probably damaging 0.99
R3910:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R3911:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R3912:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R4299:Tnfrsf11b UTSW 15 54252095 missense probably benign
R4362:Tnfrsf11b UTSW 15 54256159 missense possibly damaging 0.94
R4363:Tnfrsf11b UTSW 15 54256159 missense possibly damaging 0.94
R5288:Tnfrsf11b UTSW 15 54278226 missense probably benign 0.00
R5653:Tnfrsf11b UTSW 15 54259866 missense probably damaging 1.00
R5753:Tnfrsf11b UTSW 15 54254059 missense possibly damaging 0.90
R6997:Tnfrsf11b UTSW 15 54252374 missense probably damaging 0.99
R7704:Tnfrsf11b UTSW 15 54260101 missense probably benign 0.30
R7730:Tnfrsf11b UTSW 15 54254074 nonsense probably null
R8052:Tnfrsf11b UTSW 15 54252106 missense probably damaging 1.00
R8060:Tnfrsf11b UTSW 15 54254109 missense probably benign 0.38
X0025:Tnfrsf11b UTSW 15 54278235 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ACCATGACAATTGCAGGAGG -3'
(R):5'- ATGGTGTCTCGCAGAAAACTC -3'

Sequencing Primer
(F):5'- CGGCCCTACTACATAGACAATAG -3'
(R):5'- ATTTTTGTTGGAAGGACTGCAGAAAG -3'
Posted On2018-10-18