Mutagenetix > Incidental Mutation

Incidental Mutation 'R6881:P3h2'

536687

Institutional Source

Beutler Lab

Gene Symbol

P3h2

Ensembl Gene

ENSMUSG00000038168

Gene Name

prolyl 3-hydroxylase 2

Synonyms

Leprel1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6881 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25959288-26105784 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 25992745 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 243 (R243C)

Ref Sequence

ENSEMBL: ENSMUSP00000038056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039990]

AlphaFold

Q8CG71

Predicted Effect

probably damaging
Transcript: ENSMUST00000039990
AA Change: R243C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: R243C

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	27	36	N/A	INTRINSIC
Pfam:TPR_2	42	73	2.5e-5	PFAM
low complexity region	81	104	N/A	INTRINSIC
low complexity region	114	123	N/A	INTRINSIC
Pfam:TPR_2	206	237	1.2e-5	PFAM
low complexity region	253	266	N/A	INTRINSIC
internal_repeat_1	304	366	4.75e-7	PROSPERO
P4Hc	457	665	1.45e-51	SMART

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500009C09Rik	C	A	15: 82,259,585	H3N	possibly damaging	Het
4931406C07Rik	A	C	9: 15,290,765	C187G	possibly damaging	Het
Abhd16a	C	T	17: 35,096,601	T208I	probably benign	Het
Ahcyl1	A	T	3: 107,668,109	H425Q	probably damaging	Het
Ankrd22	T	A	19: 34,149,382	N16I	probably damaging	Het
Cc2d2b	A	G	19: 40,825,039	E1321G	probably damaging	Het
Ccdc7b	A	G	8: 129,072,547	E35G	probably damaging	Het
Chsy3	A	G	18: 59,179,408	I318V	probably damaging	Het
Clrn2	G	A	5: 45,453,822	W4*	probably null	Het
Cmip	T	C	8: 117,436,595	I355T	possibly damaging	Het
Cmya5	C	T	13: 93,090,292	V2763M	probably damaging	Het
Cnnm2	T	C	19: 46,877,219	S749P	probably damaging	Het
Cyp1a1	G	T	9: 57,700,719	R210L	possibly damaging	Het
Dmxl1	G	A	18: 49,935,305	S2715N	probably benign	Het
Dync1h1	T	C	12: 110,624,561	L1021P	probably damaging	Het
Ecm2	C	T	13: 49,530,342	Q599*	probably null	Het
Galnt11	G	T	5: 25,250,099	K144N	possibly damaging	Het
Gm45861	A	G	8: 27,535,251		probably null	Het
Kcnk18	T	A	19: 59,219,958	D75E	probably benign	Het
Kcnk2	C	T	1: 189,209,990	V346M	probably benign	Het
Klhl33	T	A	14: 50,891,472	M767L	probably benign	Het
Knl1	T	C	2: 119,095,184	I1898T	possibly damaging	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lamp3	T	C	16: 19,699,618	T290A	probably benign	Het
Larp1	T	A	11: 58,050,023	D658E	probably damaging	Het
Macf1	T	A	4: 123,432,453	I3521F	probably damaging	Het
Med12l	T	C	3: 59,267,165	S1835P	probably benign	Het
Mef2c	C	A	13: 83,592,942	N73K	probably damaging	Het
Mtmr3	T	C	11: 4,489,725	S572G	probably benign	Het
Neto2	A	T	8: 85,640,556	S520T	probably damaging	Het
Olfr1215	A	T	2: 89,001,937	M117K	probably damaging	Het
Olfr1330	A	G	4: 118,893,107	N8S	probably damaging	Het
Olfr99	A	G	17: 37,280,309	L37S	probably benign	Het
Papd5	T	C	8: 88,250,788	V363A	possibly damaging	Het
Pld1	T	C	3: 28,078,414	S584P	possibly damaging	Het
Prkcz	T	C	4: 155,269,056	N278S	possibly damaging	Het
Radil	A	G	5: 142,486,917	S913P	probably benign	Het
Retreg2	A	C	1: 75,146,439	Q337P	probably damaging	Het
Sh3gl3	A	G	7: 82,306,970	E305G	possibly damaging	Het
Shank1	G	T	7: 44,351,793	D979Y	unknown	Het
Slc35a5	A	T	16: 45,144,080	N263K	possibly damaging	Het
Slc4a7	A	T	14: 14,737,452	M127L	probably benign	Het
Slc8a2	G	A	7: 16,157,357	G774E	probably damaging	Het
Snap91	A	G	9: 86,773,593	S847P	possibly damaging	Het
Stoml1	T	C	9: 58,260,894	L296P	probably damaging	Het
Tap1	G	T	17: 34,188,034	G52V	probably damaging	Het
Tnfrsf11b	T	C	15: 54,254,143	R239G	probably benign	Het
Ttn	T	C	2: 76,706,502	Y34993C	probably damaging	Het
Uchl1	T	C	5: 66,683,722	F165L	probably damaging	Het
Xrcc1	C	T	7: 24,547,351	Q15*	probably null	Het
Zkscan7	C	G	9: 122,888,701	Q54E	possibly damaging	Het

Other mutations in P3h2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:P3h2	APN	16	25992798	missense	probably damaging	1.00
IGL01012:P3h2	APN	16	25987248	missense	probably damaging	0.98
IGL02393:P3h2	APN	16	25992825	missense	probably damaging	1.00
IGL02436:P3h2	APN	16	25997200	missense	probably benign	0.01
PIT4445001:P3h2	UTSW	16	25984999	missense	probably benign	0.01
R0319:P3h2	UTSW	16	25970931	missense	possibly damaging	0.93
R0403:P3h2	UTSW	16	25969950	missense	possibly damaging	0.63
R0962:P3h2	UTSW	16	25997248	missense	probably benign
R1290:P3h2	UTSW	16	25987203	missense	probably damaging	0.99
R1300:P3h2	UTSW	16	25997236	nonsense	probably null
R1467:P3h2	UTSW	16	25965868	splice site	probably benign
R1643:P3h2	UTSW	16	25972291	missense	probably benign	0.00
R1645:P3h2	UTSW	16	25997232	missense	probably damaging	1.00
R1761:P3h2	UTSW	16	25985050	missense	probably damaging	0.96
R4227:P3h2	UTSW	16	26105453	missense	probably benign
R4273:P3h2	UTSW	16	26105221	missense	probably benign	0.00
R4409:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4410:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4653:P3h2	UTSW	16	26105277	missense	probably damaging	0.98
R4968:P3h2	UTSW	16	25992662	critical splice donor site	probably null
R5190:P3h2	UTSW	16	25984949	missense	possibly damaging	0.86
R6113:P3h2	UTSW	16	25981153	missense	probably benign	0.01
R6225:P3h2	UTSW	16	25965743	missense	probably damaging	0.97
R6838:P3h2	UTSW	16	26105284	missense	possibly damaging	0.73
R7089:P3h2	UTSW	16	25965809	missense	probably damaging	1.00
R7445:P3h2	UTSW	16	25985065	missense	probably damaging	0.96
R7753:P3h2	UTSW	16	25970937	missense	probably damaging	1.00
R8166:P3h2	UTSW	16	25992822	missense	possibly damaging	0.89
R8363:P3h2	UTSW	16	25992718	missense	probably damaging	0.98
R8442:P3h2	UTSW	16	25987205	missense	probably benign	0.05
R8812:P3h2	UTSW	16	25982717	missense	possibly damaging	0.67
R8965:P3h2	UTSW	16	25972384	missense	probably benign	0.41
R9187:P3h2	UTSW	16	26105436	missense	probably benign	0.27
R9193:P3h2	UTSW	16	26105241	missense	probably benign	0.07
R9533:P3h2	UTSW	16	25970975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCAGGCCACATTTTGTTGG -3'
(R):5'- CACCTTCCCACGTGATCCTAAG -3'

Sequencing Primer
(F):5'- CAGGCCACATTTTGTTGGTAAGC -3'
(R):5'- CCACGTGATCCTAAGTAAGTCTGTG -3'

Posted On

2018-10-18