Mutagenetix > Incidental Mutation

Incidental Mutation 'R6882:Cnot1'

536730

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6882 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95720426 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2321 (E2321G)

Ref Sequence

ENSEMBL: ENSMUSP00000063565 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034096] [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000141900] [ENSMUST00000148727] [ENSMUST00000211887] [ENSMUST00000213006]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034096

SMART Domains

Protein: ENSMUSP00000034096
Gene: ENSMUSG00000031671

Domain	Start	End	E-Value	Type
low complexity region	18	34	N/A	INTRINSIC
SET	62	293	1.84e0	SMART
Pfam:Rubis-subs-bind	330	465	1.3e-16	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068452
AA Change: E2321G

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: E2321G

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098473
AA Change: E2371G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: E2371G

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000141900

Predicted Effect

probably benign
Transcript: ENSMUST00000148727

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211887
AA Change: E2364G

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000213006

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.9%

Validation Efficiency

100% (63/63)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr10	A	G	12: 70,956,351	E238G	probably benign	Het
Adgrf5	T	A	17: 43,450,380	C989S	probably damaging	Het
Ank2	T	G	3: 126,945,757		probably benign	Het
C2cd6	T	C	1: 59,066,159	D320G	probably damaging	Het
Cacnb2	T	A	2: 14,824,299	I15N	probably benign	Het
Cage1	T	A	13: 38,022,558	Q437L	probably damaging	Het
Capn15	G	T	17: 25,960,179		probably null	Het
Cbll1	A	G	12: 31,487,485	Y424H	probably damaging	Het
Ccdc166	T	C	15: 75,981,617	H167R	possibly damaging	Het
Ccdc7a	T	C	8: 128,797,328		probably benign	Het
Cdkl4	T	A	17: 80,543,746	T176S	probably damaging	Het
Col6a5	G	A	9: 105,940,270	Q281*	probably null	Het
Csmd2	A	G	4: 128,449,269	T1485A	probably benign	Het
Dmxl1	A	G	18: 49,843,784		probably null	Het
Dnah3	A	G	7: 119,971,184	I2271T	possibly damaging	Het
Elavl2	A	G	4: 91,308,715	I42T	probably damaging	Het
Epn3	C	T	11: 94,491,360	A568T	probably benign	Het
Etv3	T	C	3: 87,529,270	F111L	probably damaging	Het
Fnip1	A	G	11: 54,509,898	E1041G	probably damaging	Het
Fosl2	T	C	5: 32,152,864	V219A	possibly damaging	Het
Foxj2	T	A	6: 122,828,505		probably null	Het
Gm8947	G	A	1: 151,193,129	A238T	possibly damaging	Het
Golgb1	C	A	16: 36,913,990	Q1200K	probably benign	Het
Igkv4-55	A	G	6: 69,607,305	Y108H	probably damaging	Het
Iglc1	G	A	16: 19,061,849		probably benign	Het
Ints13	G	T	6: 146,563,441	R221S	probably null	Het
Ipo11	T	C	13: 106,900,682		probably null	Het
Kcnn2	A	T	18: 45,559,438	H27L	possibly damaging	Het
Kcns3	C	T	12: 11,092,048	V217M	probably benign	Het
Klra9	A	T	6: 130,179,022	C257S	probably damaging	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lmbr1l	A	G	15: 98,907,586	F345L	probably damaging	Het
Lrrc18	A	C	14: 33,008,689	I62L	probably benign	Het
Mr1	A	G	1: 155,132,453	W259R	possibly damaging	Het
Myo15	G	A	11: 60,524,006	R3325H	probably damaging	Het
Nid2	A	G	14: 19,789,707	D788G	probably damaging	Het
Olfr1386	A	T	11: 49,470,463	Y104F	probably benign	Het
Olfr1436	C	A	19: 12,298,570	Q187H	probably damaging	Het
Olfr192	A	T	16: 59,098,627	C122S	unknown	Het
Olfr212	T	C	6: 116,516,434	V219A	probably benign	Het
Pbld1	T	C	10: 63,061,462	L11P	probably benign	Het
Pcnt	T	C	10: 76,427,828	E434G	probably benign	Het
Prg4	G	A	1: 150,453,495	T174M	probably damaging	Het
Prkdc	G	A	16: 15,783,263		probably null	Het
Prkdc	T	A	16: 15,808,156	S3349T	probably benign	Het
Prpf38a	C	A	4: 108,570,168	E199D	probably benign	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Rhbg	T	A	3: 88,245,220	H339L	probably damaging	Het
Rnf183	A	G	4: 62,428,024	I179T	probably benign	Het
Sh3bp5l	G	T	11: 58,331,699	A7S	probably benign	Het
Slc12a3	T	A	8: 94,365,918	I989N	possibly damaging	Het
Sycp3	C	T	10: 88,472,929	R246*	probably null	Het
Tmprss11b	T	A	5: 86,671,671		probably null	Het
Tmx4	T	C	2: 134,644,002	T2A	possibly damaging	Het
Tnfsf10	T	C	3: 27,326,033	L82S	possibly damaging	Het
Tnni3k	T	A	3: 154,957,720	I332F	possibly damaging	Het
Ttn	T	A	2: 76,814,195	T13072S	probably benign	Het
Vmn2r1	A	T	3: 64,090,108	Y395F	possibly damaging	Het
Zbbx	A	G	3: 75,071,712	V476A	probably benign	Het
Zfp341	T	C	2: 154,638,023	C465R	probably damaging	Het
Zfp398	A	G	6: 47,866,082	D224G	probably damaging	Het
Zfp407	G	T	18: 84,343,069		probably null	Het
Zfp52	T	C	17: 21,555,047	M1T	probably null	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
Quorum	UTSW	8	95726118	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9179:Cnot1	UTSW	8	95773426	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	95770710	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	95756226	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	95756207	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	95729246	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	95761391	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	95769581	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	95729144	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GAACTTGCCCACATAGACAGG -3'
(R):5'- TGTGCCCCAGAGATTGAAAAG -3'

Sequencing Primer
(F):5'- GGAGATCAACCCCAGCAGTTG -3'
(R):5'- TGTTAATTACCAAGCAGGGAGAC -3'

Posted On

2018-10-18