Incidental Mutation 'R6882:Epn3'
ID536739
Institutional Source Beutler Lab
Gene Symbol Epn3
Ensembl Gene ENSMUSG00000010080
Gene Nameepsin 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6882 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94489599-94499974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94491360 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 568 (A568T)
Ref Sequence ENSEMBL: ENSMUSP00000121390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127305]
Predicted Effect probably benign
Transcript: ENSMUST00000127305
AA Change: A568T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121390
Gene: ENSMUSG00000010080
AA Change: A568T

DomainStartEndE-ValueType
ENTH 18 144 1.3e-62 SMART
low complexity region 167 190 N/A INTRINSIC
UIM 202 221 2.11e-2 SMART
UIM 229 248 5.27e-3 SMART
low complexity region 269 285 N/A INTRINSIC
low complexity region 554 572 N/A INTRINSIC
low complexity region 578 588 N/A INTRINSIC
low complexity region 599 618 N/A INTRINSIC
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr10 A G 12: 70,956,351 E238G probably benign Het
Adgrf5 T A 17: 43,450,380 C989S probably damaging Het
Ank2 T G 3: 126,945,757 probably benign Het
C2cd6 T C 1: 59,066,159 D320G probably damaging Het
Cacnb2 T A 2: 14,824,299 I15N probably benign Het
Cage1 T A 13: 38,022,558 Q437L probably damaging Het
Capn15 G T 17: 25,960,179 probably null Het
Cbll1 A G 12: 31,487,485 Y424H probably damaging Het
Ccdc166 T C 15: 75,981,617 H167R possibly damaging Het
Ccdc7a T C 8: 128,797,328 probably benign Het
Cdkl4 T A 17: 80,543,746 T176S probably damaging Het
Cnot1 T C 8: 95,720,426 E2321G possibly damaging Het
Col6a5 G A 9: 105,940,270 Q281* probably null Het
Csmd2 A G 4: 128,449,269 T1485A probably benign Het
Dmxl1 A G 18: 49,843,784 probably null Het
Dnah3 A G 7: 119,971,184 I2271T possibly damaging Het
Elavl2 A G 4: 91,308,715 I42T probably damaging Het
Etv3 T C 3: 87,529,270 F111L probably damaging Het
Fnip1 A G 11: 54,509,898 E1041G probably damaging Het
Fosl2 T C 5: 32,152,864 V219A possibly damaging Het
Foxj2 T A 6: 122,828,505 probably null Het
Gm8947 G A 1: 151,193,129 A238T possibly damaging Het
Golgb1 C A 16: 36,913,990 Q1200K probably benign Het
Igkv4-55 A G 6: 69,607,305 Y108H probably damaging Het
Iglc1 G A 16: 19,061,849 probably benign Het
Ints13 G T 6: 146,563,441 R221S probably null Het
Ipo11 T C 13: 106,900,682 probably null Het
Kcnn2 A T 18: 45,559,438 H27L possibly damaging Het
Kcns3 C T 12: 11,092,048 V217M probably benign Het
Klra9 A T 6: 130,179,022 C257S probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lmbr1l A G 15: 98,907,586 F345L probably damaging Het
Lrrc18 A C 14: 33,008,689 I62L probably benign Het
Mr1 A G 1: 155,132,453 W259R possibly damaging Het
Myo15 G A 11: 60,524,006 R3325H probably damaging Het
Nid2 A G 14: 19,789,707 D788G probably damaging Het
Olfr1386 A T 11: 49,470,463 Y104F probably benign Het
Olfr1436 C A 19: 12,298,570 Q187H probably damaging Het
Olfr192 A T 16: 59,098,627 C122S unknown Het
Olfr212 T C 6: 116,516,434 V219A probably benign Het
Pbld1 T C 10: 63,061,462 L11P probably benign Het
Pcnt T C 10: 76,427,828 E434G probably benign Het
Prg4 G A 1: 150,453,495 T174M probably damaging Het
Prkdc G A 16: 15,783,263 probably null Het
Prkdc T A 16: 15,808,156 S3349T probably benign Het
Prpf38a C A 4: 108,570,168 E199D probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Rhbg T A 3: 88,245,220 H339L probably damaging Het
Rnf183 A G 4: 62,428,024 I179T probably benign Het
Sh3bp5l G T 11: 58,331,699 A7S probably benign Het
Slc12a3 T A 8: 94,365,918 I989N possibly damaging Het
Sycp3 C T 10: 88,472,929 R246* probably null Het
Tmprss11b T A 5: 86,671,671 probably null Het
Tmx4 T C 2: 134,644,002 T2A possibly damaging Het
Tnfsf10 T C 3: 27,326,033 L82S possibly damaging Het
Tnni3k T A 3: 154,957,720 I332F possibly damaging Het
Ttn T A 2: 76,814,195 T13072S probably benign Het
Vmn2r1 A T 3: 64,090,108 Y395F possibly damaging Het
Zbbx A G 3: 75,071,712 V476A probably benign Het
Zfp341 T C 2: 154,638,023 C465R probably damaging Het
Zfp398 A G 6: 47,866,082 D224G probably damaging Het
Zfp407 G T 18: 84,343,069 probably null Het
Zfp52 T C 17: 21,555,047 M1T probably null Het
Other mutations in Epn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Epn3 APN 11 94495026 missense probably benign 0.04
IGL03172:Epn3 APN 11 94491630 missense possibly damaging 0.92
PIT4362001:Epn3 UTSW 11 94496523 missense probably damaging 1.00
PIT4418001:Epn3 UTSW 11 94496130 missense probably damaging 1.00
R4893:Epn3 UTSW 11 94491996 missense probably damaging 0.99
R5173:Epn3 UTSW 11 94496097 missense probably damaging 0.97
R6526:Epn3 UTSW 11 94494932 critical splice donor site probably null
R7120:Epn3 UTSW 11 94492428 missense probably benign 0.41
R7326:Epn3 UTSW 11 94493780 missense probably benign 0.02
R7861:Epn3 UTSW 11 94496274 missense probably damaging 1.00
R7944:Epn3 UTSW 11 94496274 missense probably damaging 1.00
T0975:Epn3 UTSW 11 94491907 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGGATTAGTGCCAGCCTG -3'
(R):5'- CTGACAGGTAGAGCATTCTGG -3'

Sequencing Primer
(F):5'- CAGCAGTGGCTGAGGCAA -3'
(R):5'- CAGGTAGAGCATTCTGGCCTGG -3'
Posted On2018-10-18