Incidental Mutation 'R6885:Ankar'
ID536762
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Nameankyrin and armadillo repeat containing
Synonyms4932422E22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6885 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location72642980-72700579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72643036 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1239 (A1239T)
Ref Sequence ENSEMBL: ENSMUSP00000148640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
Predicted Effect unknown
Transcript: ENSMUST00000053499
AA Change: A1457T
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: A1457T

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000211837
AA Change: A1456T
Predicted Effect unknown
Transcript: ENSMUST00000212573
AA Change: A1239T
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,520,109 I1025M probably benign Het
Adamtsl5 T A 10: 80,343,631 T164S probably benign Het
Aox4 A T 1: 58,264,378 S1192C probably damaging Het
Atl2 T C 17: 79,852,553 D68G probably damaging Het
Btnl4 T C 17: 34,472,945 I228V probably benign Het
Catsper4 T C 4: 134,215,149 T231A probably benign Het
Ccl12 A T 11: 82,102,697 T54S probably damaging Het
Cntn1 T C 15: 92,243,099 probably null Het
Cog5 T A 12: 31,894,199 D694E probably damaging Het
Crat T A 2: 30,415,196 probably benign Het
Crot T C 5: 8,973,635 T418A probably benign Het
Cubn G A 2: 13,318,278 P2826L probably damaging Het
Dnah17 A G 11: 118,090,772 F1698L possibly damaging Het
Dock8 T A 19: 25,147,378 D1019E possibly damaging Het
Eps15 A G 4: 109,309,164 N85D probably damaging Het
Exoc1 T C 5: 76,559,042 S457P probably damaging Het
Ext1 G A 15: 53,101,692 T426I probably damaging Het
Fat1 T C 8: 44,952,452 S747P possibly damaging Het
Gas7 A G 11: 67,683,387 D396G probably damaging Het
Gm13023 T C 4: 143,793,533 C116R probably damaging Het
Gm5114 G T 7: 39,408,156 R680S probably benign Het
Gpcpd1 A T 2: 132,554,074 L94M possibly damaging Het
Gse1 C A 8: 120,229,482 probably benign Het
Hmgb1 T C 5: 149,050,661 E26G probably benign Het
Incenp C T 19: 9,875,132 R714Q unknown Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Ksr1 A G 11: 79,047,295 probably null Het
Lpin2 T G 17: 71,215,150 S60A probably damaging Het
Lrrc71 T C 3: 87,742,620 probably null Het
Mafb A G 2: 160,366,019 S220P possibly damaging Het
Maml3 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC 3: 51,697,579 Het
Mcmbp T C 7: 128,725,109 probably null Het
Olfr1191-ps1 A G 2: 88,643,597 T277A probably damaging Het
Olfr390 A T 11: 73,787,100 H54L possibly damaging Het
Paqr9 T C 9: 95,560,043 S29P probably benign Het
Parm1 A G 5: 91,594,210 T146A possibly damaging Het
Pgm1 T A 5: 64,103,878 F238L probably benign Het
Pigv A T 4: 133,665,481 F126Y probably damaging Het
Pitx2 T C 3: 129,218,608 M222T probably damaging Het
Plekhg6 T C 6: 125,378,730 N37S probably benign Het
Psme4 A T 11: 30,834,307 K961* probably null Het
Rbpj T C 5: 53,653,151 W392R probably damaging Het
Reg3a T A 6: 78,381,055 probably null Het
Rfc3 C T 5: 151,648,284 S85N probably benign Het
Rtn3 T C 19: 7,458,331 T80A probably benign Het
Sash1 T C 10: 8,784,221 T195A probably damaging Het
Ska1 A G 18: 74,206,839 V12A probably benign Het
Slc25a1 A G 16: 17,927,430 V80A probably benign Het
Slc26a5 A T 5: 21,834,344 V217D probably damaging Het
Slc46a1 A G 11: 78,466,979 D286G probably benign Het
Spata2l A T 8: 123,235,558 L88Q probably damaging Het
Sptbn1 T G 11: 30,138,634 Q876P probably benign Het
Tenm2 T A 11: 36,023,580 I2377F possibly damaging Het
Thbs4 A T 13: 92,762,869 D539E probably damaging Het
Tmem154 T A 3: 84,692,506 C162S possibly damaging Het
Tpcn1 T C 5: 120,544,437 E502G probably benign Het
Traf7 G A 17: 24,512,292 R257C probably benign Het
Tsc22d2 T C 3: 58,416,208 Y174H probably damaging Het
Usp8 A G 2: 126,752,310 E802G probably damaging Het
Vmn1r5 T C 6: 56,986,057 V239A possibly damaging Het
Vmn2r99 T A 17: 19,380,195 S494T possibly damaging Het
Zbtb38 A G 9: 96,686,464 F856L probably damaging Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 splice site probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7424:Ankar UTSW 1 72680058 missense probably damaging 1.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
R7618:Ankar UTSW 1 72675766 missense probably benign 0.22
R7659:Ankar UTSW 1 72690135 missense possibly damaging 0.95
R7974:Ankar UTSW 1 72698979 nonsense probably null
R8008:Ankar UTSW 1 72666484 missense possibly damaging 0.47
R8119:Ankar UTSW 1 72647001 missense probably damaging 0.98
R8244:Ankar UTSW 1 72651024 missense probably benign
R8342:Ankar UTSW 1 72652460 missense probably damaging 1.00
R8494:Ankar UTSW 1 72658794 missense probably benign 0.16
R8851:Ankar UTSW 1 72652376 missense probably damaging 1.00
Z1176:Ankar UTSW 1 72689961 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCATGTGAAATTCTGGGAAGAAATC -3'
(R):5'- CTAACGTCAAGGAGCTCTTCAGAAC -3'

Sequencing Primer
(F):5'- CATTCCCTGAAGATGCTG -3'
(R):5'- GTCAAGGAGCTCTTCAGAACAACAC -3'
Posted On2018-10-18