Mutagenetix > Incidental Mutation

Incidental Mutation 'R6885:Usp8'

536766

Institutional Source

Beutler Lab

Gene Symbol

Usp8

Ensembl Gene

ENSMUSG00000027363

Gene Name

ubiquitin specific peptidase 8

Synonyms

Ubpy

MMRRC Submission

045031-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6885 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

126707328-126759297 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126752310 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 802 (E802G)

Ref Sequence

ENSEMBL: ENSMUSP00000106046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028841] [ENSMUST00000110416] [ENSMUST00000136319]

AlphaFold

Q80U87

Predicted Effect

probably damaging
Transcript: ENSMUST00000028841
AA Change: E791G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028841
Gene: ENSMUSG00000027363
AA Change: E791G

Domain	Start	End	E-Value	Type
Pfam:USP8_dimer	6	116	2.3e-37	PFAM
low complexity region	119	140	N/A	INTRINSIC
RHOD	185	310	3.69e-7	SMART
low complexity region	378	393	N/A	INTRINSIC
coiled coil region	467	501	N/A	INTRINSIC
low complexity region	642	657	N/A	INTRINSIC
Pfam:UCH	738	1068	4e-88	PFAM
Pfam:UCH_1	739	1053	1.9e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110416
AA Change: E802G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106046
Gene: ENSMUSG00000027363
AA Change: E802G

Domain	Start	End	E-Value	Type
Pfam:USP8_dimer	6	127	2.5e-36	PFAM
low complexity region	130	151	N/A	INTRINSIC
RHOD	196	321	3.69e-7	SMART
low complexity region	389	404	N/A	INTRINSIC
coiled coil region	478	512	N/A	INTRINSIC
low complexity region	653	668	N/A	INTRINSIC
Pfam:UCH	749	1079	1.3e-82	PFAM
Pfam:UCH_1	750	1064	3.7e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136319

SMART Domains

Protein: ENSMUSP00000121578
Gene: ENSMUSG00000027364

Domain	Start	End	E-Value	Type
Pfam:UCH	1	268	1.9e-39	PFAM
Pfam:UCH_1	1	269	1.3e-14	PFAM

Meta Mutation Damage Score

0.3616

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the ubiquitin-specific processing protease family of proteins. The encoded protein is thought to regulate the morphology of the endosome by ubiquitination of proteins on this organelle and is involved in cargo sorting and membrane trafficking at the early endosome stage. This protein is required for the cell to enter the S phase of the cell cycle and also functions as a positive regulator in the Hedgehog signaling pathway in development. Pseudogenes of this gene are present on chromosomes 2 and 6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele appear severely growth retarded and disorganized at E9.5 and die in utero due to ventral-folding defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	G	7: 120,520,109	I1025M	probably benign	Het
Adamtsl5	T	A	10: 80,343,631	T164S	probably benign	Het
Ankar	C	T	1: 72,643,036	A1239T	unknown	Het
Aox4	A	T	1: 58,264,378	S1192C	probably damaging	Het
Atl2	T	C	17: 79,852,553	D68G	probably damaging	Het
Btnl4	T	C	17: 34,472,945	I228V	probably benign	Het
Catsper4	T	C	4: 134,215,149	T231A	probably benign	Het
Ccl12	A	T	11: 82,102,697	T54S	probably damaging	Het
Cntn1	T	C	15: 92,243,099		probably null	Het
Cog5	T	A	12: 31,894,199	D694E	probably damaging	Het
Crat	T	A	2: 30,415,196		probably benign	Het
Crot	T	C	5: 8,973,635	T418A	probably benign	Het
Cubn	G	A	2: 13,318,278	P2826L	probably damaging	Het
Dnah17	A	G	11: 118,090,772	F1698L	possibly damaging	Het
Dock8	T	A	19: 25,147,378	D1019E	possibly damaging	Het
Eps15	A	G	4: 109,309,164	N85D	probably damaging	Het
Exoc1	T	C	5: 76,559,042	S457P	probably damaging	Het
Ext1	G	A	15: 53,101,692	T426I	probably damaging	Het
Fat1	T	C	8: 44,952,452	S747P	possibly damaging	Het
Gas7	A	G	11: 67,683,387	D396G	probably damaging	Het
Gm13023	T	C	4: 143,793,533	C116R	probably damaging	Het
Gm5114	G	T	7: 39,408,156	R680S	probably benign	Het
Gpcpd1	A	T	2: 132,554,074	L94M	possibly damaging	Het
Gse1	C	A	8: 120,229,482		probably benign	Het
Hmgb1	T	C	5: 149,050,661	E26G	probably benign	Het
Incenp	C	T	19: 9,875,132	R714Q	unknown	Het
Krt73	T	C	15: 101,796,398	E351G	probably damaging	Het
Ksr1	A	G	11: 79,047,295		probably null	Het
Lpin2	T	G	17: 71,215,150	S60A	probably damaging	Het
Lrrc71	T	C	3: 87,742,620		probably null	Het
Mafb	A	G	2: 160,366,019	S220P	possibly damaging	Het
Maml3	TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC	TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC	3: 51,697,579			Het
Mcmbp	T	C	7: 128,725,109		probably null	Het
Olfr1191-ps1	A	G	2: 88,643,597	T277A	probably damaging	Het
Olfr390	A	T	11: 73,787,100	H54L	possibly damaging	Het
Paqr9	T	C	9: 95,560,043	S29P	probably benign	Het
Parm1	A	G	5: 91,594,210	T146A	possibly damaging	Het
Pgm1	T	A	5: 64,103,878	F238L	probably benign	Het
Pigv	A	T	4: 133,665,481	F126Y	probably damaging	Het
Pitx2	T	C	3: 129,218,608	M222T	probably damaging	Het
Plekhg6	T	C	6: 125,378,730	N37S	probably benign	Het
Psme4	A	T	11: 30,834,307	K961*	probably null	Het
Rbpj	T	C	5: 53,653,151	W392R	probably damaging	Het
Reg3a	T	A	6: 78,381,055		probably null	Het
Rfc3	C	T	5: 151,648,284	S85N	probably benign	Het
Rtn3	T	C	19: 7,458,331	T80A	probably benign	Het
Sash1	T	C	10: 8,784,221	T195A	probably damaging	Het
Ska1	A	G	18: 74,206,839	V12A	probably benign	Het
Slc25a1	A	G	16: 17,927,430	V80A	probably benign	Het
Slc26a5	A	T	5: 21,834,344	V217D	probably damaging	Het
Slc46a1	A	G	11: 78,466,979	D286G	probably benign	Het
Spata2l	A	T	8: 123,235,558	L88Q	probably damaging	Het
Sptbn1	T	G	11: 30,138,634	Q876P	probably benign	Het
Tenm2	T	A	11: 36,023,580	I2377F	possibly damaging	Het
Thbs4	A	T	13: 92,762,869	D539E	probably damaging	Het
Tmem154	T	A	3: 84,692,506	C162S	possibly damaging	Het
Tpcn1	T	C	5: 120,544,437	E502G	probably benign	Het
Traf7	G	A	17: 24,512,292	R257C	probably benign	Het
Tsc22d2	T	C	3: 58,416,208	Y174H	probably damaging	Het
Vmn1r5	T	C	6: 56,986,057	V239A	possibly damaging	Het
Vmn2r99	T	A	17: 19,380,195	S494T	possibly damaging	Het
Zbtb38	A	G	9: 96,686,464	F856L	probably damaging	Het

Other mutations in Usp8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Usp8	APN	2	126758560	missense	probably damaging	1.00
IGL00771:Usp8	APN	2	126725433	splice site	probably null
IGL01073:Usp8	APN	2	126718114	missense	probably damaging	0.96
IGL01722:Usp8	APN	2	126758152	missense	probably damaging	1.00
IGL02100:Usp8	APN	2	126737854	intron	probably benign
IGL02210:Usp8	APN	2	126718056	intron	probably benign
IGL02516:Usp8	APN	2	126742174	missense	probably benign	0.00
IGL02743:Usp8	APN	2	126734023	missense	probably damaging	1.00
IGL02953:Usp8	APN	2	126737937	missense	probably benign
Satsuke	UTSW	2	126751111	missense	probably damaging	1.00
R0045:Usp8	UTSW	2	126742223	missense	probably benign	0.03
R0048:Usp8	UTSW	2	126737889	missense	probably damaging	0.96
R0048:Usp8	UTSW	2	126737889	missense	probably damaging	0.96
R0143:Usp8	UTSW	2	126755089	intron	probably benign
R0427:Usp8	UTSW	2	126718032	intron	probably benign
R0440:Usp8	UTSW	2	126725390	missense	probably benign	0.00
R0636:Usp8	UTSW	2	126720110	missense	possibly damaging	0.87
R0828:Usp8	UTSW	2	126742114	intron	probably benign
R1468:Usp8	UTSW	2	126754927	missense	probably damaging	1.00
R1468:Usp8	UTSW	2	126754927	missense	probably damaging	1.00
R1782:Usp8	UTSW	2	126720051	missense	probably damaging	1.00
R1860:Usp8	UTSW	2	126756040	missense	probably damaging	1.00
R2127:Usp8	UTSW	2	126737575	splice site	probably null
R2259:Usp8	UTSW	2	126758568	missense	probably benign	0.32
R2892:Usp8	UTSW	2	126758155	missense	probably damaging	1.00
R2893:Usp8	UTSW	2	126758155	missense	probably damaging	1.00
R3104:Usp8	UTSW	2	126758512	missense	probably damaging	1.00
R4074:Usp8	UTSW	2	126752370	missense	probably damaging	1.00
R4678:Usp8	UTSW	2	126725429	missense	probably null	1.00
R4715:Usp8	UTSW	2	126729222	missense	possibly damaging	0.80
R4832:Usp8	UTSW	2	126755038	missense	probably damaging	1.00
R4914:Usp8	UTSW	2	126720140	nonsense	probably null
R4915:Usp8	UTSW	2	126720140	nonsense	probably null
R4918:Usp8	UTSW	2	126720140	nonsense	probably null
R5262:Usp8	UTSW	2	126751111	missense	probably damaging	1.00
R5625:Usp8	UTSW	2	126742277	missense	probably damaging	1.00
R5667:Usp8	UTSW	2	126742425	missense	probably benign	0.00
R5671:Usp8	UTSW	2	126742425	missense	probably benign	0.00
R5984:Usp8	UTSW	2	126742481	missense	probably benign	0.10
R6529:Usp8	UTSW	2	126725378	missense	probably benign	0.01
R6551:Usp8	UTSW	2	126733182	intron	probably benign
R7768:Usp8	UTSW	2	126751123	missense	probably damaging	1.00
R8097:Usp8	UTSW	2	126754880	missense	probably benign	0.44
R8130:Usp8	UTSW	2	126717998	intron	probably benign
R8379:Usp8	UTSW	2	126742571	missense	probably benign
R8412:Usp8	UTSW	2	126742658	missense	probably benign
R8880:Usp8	UTSW	2	126748309	missense	probably damaging	1.00
R9113:Usp8	UTSW	2	126737423	missense	probably benign
R9198:Usp8	UTSW	2	126758604	makesense	probably null
R9280:Usp8	UTSW	2	126720024	missense	unknown
R9441:Usp8	UTSW	2	126720153	missense	possibly damaging	0.56
R9561:Usp8	UTSW	2	126736494	missense	probably damaging	1.00
Z1177:Usp8	UTSW	2	126758431	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGCAGCCTGTTGATGTG -3'
(R):5'- ATTCAGATCCTCATGCAGGCC -3'

Sequencing Primer
(F):5'- CCATAGCAAAGTCAGGTTCAGATGTG -3'
(R):5'- TCATGCAGGCCATCCATGAG -3'

Posted On

2018-10-18