Incidental Mutation 'R6885:Mafb'
ID536768
Institutional Source Beutler Lab
Gene Symbol Mafb
Ensembl Gene ENSMUSG00000074622
Gene Namev-maf musculoaponeurotic fibrosarcoma oncogene family, protein B (avian)
SynonymsKrml1, Krml, Kreisler
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock #R6885 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location160363703-160367065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 160366019 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 220 (S220P)
Ref Sequence ENSEMBL: ENSMUSP00000096728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099126]
PDB Structure
Crystal structure of the bZIP heterodimeric complex MafB:cFos bound to DNA [X-RAY DIFFRACTION]
Crystal structure of the homodimeric MafB in complex with the T-MARE binding site [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE BZIP HOMODIMERIC MAFB IN COMPLEX WITH THE C- MARE BINDING SITE [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099126
AA Change: S220P

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096728
Gene: ENSMUSG00000074622
AA Change: S220P

DomainStartEndE-ValueType
low complexity region 54 78 N/A INTRINSIC
Pfam:Maf_N 80 113 2.1e-24 PFAM
low complexity region 131 143 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
BRLZ 234 300 2.73e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a basic leucine zipper (bZIP) transcription factor that plays an important role in the regulation of lineage-specific hematopoiesis. The encoded nuclear protein represses ETS1-mediated transcription of erythroid-specific genes in myeloid cells. This gene contains no introns. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant homozygotes exhibit segmentation defects in the caudal hindbrain, loss of facial motor neurons, impaired inner ear development, arrested maturation of kidney podocytes, reduced fertility, and, in some cases, lethality at birth from apnea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,520,109 I1025M probably benign Het
Adamtsl5 T A 10: 80,343,631 T164S probably benign Het
Ankar C T 1: 72,643,036 A1239T unknown Het
Aox4 A T 1: 58,264,378 S1192C probably damaging Het
Atl2 T C 17: 79,852,553 D68G probably damaging Het
Btnl4 T C 17: 34,472,945 I228V probably benign Het
Catsper4 T C 4: 134,215,149 T231A probably benign Het
Ccl12 A T 11: 82,102,697 T54S probably damaging Het
Cntn1 T C 15: 92,243,099 probably null Het
Cog5 T A 12: 31,894,199 D694E probably damaging Het
Crat T A 2: 30,415,196 probably benign Het
Crot T C 5: 8,973,635 T418A probably benign Het
Cubn G A 2: 13,318,278 P2826L probably damaging Het
Dnah17 A G 11: 118,090,772 F1698L possibly damaging Het
Dock8 T A 19: 25,147,378 D1019E possibly damaging Het
Eps15 A G 4: 109,309,164 N85D probably damaging Het
Exoc1 T C 5: 76,559,042 S457P probably damaging Het
Ext1 G A 15: 53,101,692 T426I probably damaging Het
Fat1 T C 8: 44,952,452 S747P possibly damaging Het
Gas7 A G 11: 67,683,387 D396G probably damaging Het
Gm13023 T C 4: 143,793,533 C116R probably damaging Het
Gm5114 G T 7: 39,408,156 R680S probably benign Het
Gpcpd1 A T 2: 132,554,074 L94M possibly damaging Het
Gse1 C A 8: 120,229,482 probably benign Het
Hmgb1 T C 5: 149,050,661 E26G probably benign Het
Incenp C T 19: 9,875,132 R714Q unknown Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Ksr1 A G 11: 79,047,295 probably null Het
Lpin2 T G 17: 71,215,150 S60A probably damaging Het
Lrrc71 T C 3: 87,742,620 probably null Het
Maml3 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC 3: 51,697,579 Het
Mcmbp T C 7: 128,725,109 probably null Het
Olfr1191-ps1 A G 2: 88,643,597 T277A probably damaging Het
Olfr390 A T 11: 73,787,100 H54L possibly damaging Het
Paqr9 T C 9: 95,560,043 S29P probably benign Het
Parm1 A G 5: 91,594,210 T146A possibly damaging Het
Pgm1 T A 5: 64,103,878 F238L probably benign Het
Pigv A T 4: 133,665,481 F126Y probably damaging Het
Pitx2 T C 3: 129,218,608 M222T probably damaging Het
Plekhg6 T C 6: 125,378,730 N37S probably benign Het
Psme4 A T 11: 30,834,307 K961* probably null Het
Rbpj T C 5: 53,653,151 W392R probably damaging Het
Reg3a T A 6: 78,381,055 probably null Het
Rfc3 C T 5: 151,648,284 S85N probably benign Het
Rtn3 T C 19: 7,458,331 T80A probably benign Het
Sash1 T C 10: 8,784,221 T195A probably damaging Het
Ska1 A G 18: 74,206,839 V12A probably benign Het
Slc25a1 A G 16: 17,927,430 V80A probably benign Het
Slc26a5 A T 5: 21,834,344 V217D probably damaging Het
Slc46a1 A G 11: 78,466,979 D286G probably benign Het
Spata2l A T 8: 123,235,558 L88Q probably damaging Het
Sptbn1 T G 11: 30,138,634 Q876P probably benign Het
Tenm2 T A 11: 36,023,580 I2377F possibly damaging Het
Thbs4 A T 13: 92,762,869 D539E probably damaging Het
Tmem154 T A 3: 84,692,506 C162S possibly damaging Het
Tpcn1 T C 5: 120,544,437 E502G probably benign Het
Traf7 G A 17: 24,512,292 R257C probably benign Het
Tsc22d2 T C 3: 58,416,208 Y174H probably damaging Het
Usp8 A G 2: 126,752,310 E802G probably damaging Het
Vmn1r5 T C 6: 56,986,057 V239A possibly damaging Het
Vmn2r99 T A 17: 19,380,195 S494T possibly damaging Het
Zbtb38 A G 9: 96,686,464 F856L probably damaging Het
Other mutations in Mafb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01827:Mafb APN 2 160366478 missense probably damaging 1.00
IGL02077:Mafb APN 2 160365767 missense probably benign 0.32
R2240:Mafb UTSW 2 160366027 missense probably damaging 1.00
R2510:Mafb UTSW 2 160366576 missense probably damaging 1.00
R5784:Mafb UTSW 2 160366541 missense probably damaging 0.99
R6341:Mafb UTSW 2 160366451 missense probably damaging 0.99
R7555:Mafb UTSW 2 160365829 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCTTGTAGGCGTCTCTC -3'
(R):5'- GTGTGACTCACGATGACCTG -3'

Sequencing Primer
(F):5'- GGACACCTCCTGCTTAAGCTG -3'
(R):5'- TCACGATGACCTGGGCCAG -3'
Posted On2018-10-18