Mutagenetix > Incidental Mutation

Incidental Mutation 'R6885:Abca16'

536790

Institutional Source

Beutler Lab

Gene Symbol

Abca16

Ensembl Gene

ENSMUSG00000051900

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 16

Synonyms

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6885 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120409647-120544813 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120520109 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 1025 (I1025M)

Ref Sequence

ENSEMBL: ENSMUSP00000112736 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]

AlphaFold

E9PWJ7

Predicted Effect

probably benign
Transcript: ENSMUST00000056042
AA Change: I1024M

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: I1024M

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	26	455	2.7e-23	PFAM
AAA	537	720	2.01e-7	SMART
Pfam:ABC2_membrane_3	898	1287	4.6e-25	PFAM
low complexity region	1325	1336	N/A	INTRINSIC
low complexity region	1342	1353	N/A	INTRINSIC
AAA	1378	1563	4.23e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120490
AA Change: I1025M

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: I1025M

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	25	456	2.4e-22	PFAM
AAA	538	721	2.01e-7	SMART
Pfam:ABC2_membrane_3	899	1288	1.1e-27	PFAM
low complexity region	1326	1337	N/A	INTRINSIC
low complexity region	1343	1354	N/A	INTRINSIC
AAA	1379	1564	4.23e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

98% (58/59)

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl5	T	A	10: 80,343,631	T164S	probably benign	Het
Ankar	C	T	1: 72,643,036	A1239T	unknown	Het
Aox4	A	T	1: 58,264,378	S1192C	probably damaging	Het
Atl2	T	C	17: 79,852,553	D68G	probably damaging	Het
Btnl4	T	C	17: 34,472,945	I228V	probably benign	Het
Catsper4	T	C	4: 134,215,149	T231A	probably benign	Het
Ccl12	A	T	11: 82,102,697	T54S	probably damaging	Het
Cntn1	T	C	15: 92,243,099		probably null	Het
Cog5	T	A	12: 31,894,199	D694E	probably damaging	Het
Crat	T	A	2: 30,415,196		probably benign	Het
Crot	T	C	5: 8,973,635	T418A	probably benign	Het
Cubn	G	A	2: 13,318,278	P2826L	probably damaging	Het
Dnah17	A	G	11: 118,090,772	F1698L	possibly damaging	Het
Dock8	T	A	19: 25,147,378	D1019E	possibly damaging	Het
Eps15	A	G	4: 109,309,164	N85D	probably damaging	Het
Exoc1	T	C	5: 76,559,042	S457P	probably damaging	Het
Ext1	G	A	15: 53,101,692	T426I	probably damaging	Het
Fat1	T	C	8: 44,952,452	S747P	possibly damaging	Het
Gas7	A	G	11: 67,683,387	D396G	probably damaging	Het
Gm13023	T	C	4: 143,793,533	C116R	probably damaging	Het
Gm5114	G	T	7: 39,408,156	R680S	probably benign	Het
Gpcpd1	A	T	2: 132,554,074	L94M	possibly damaging	Het
Gse1	C	A	8: 120,229,482		probably benign	Het
Hmgb1	T	C	5: 149,050,661	E26G	probably benign	Het
Incenp	C	T	19: 9,875,132	R714Q	unknown	Het
Krt73	T	C	15: 101,796,398	E351G	probably damaging	Het
Ksr1	A	G	11: 79,047,295		probably null	Het
Lpin2	T	G	17: 71,215,150	S60A	probably damaging	Het
Lrrc71	T	C	3: 87,742,620		probably null	Het
Mafb	A	G	2: 160,366,019	S220P	possibly damaging	Het
Maml3	TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC	TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC	3: 51,697,579			Het
Mcmbp	T	C	7: 128,725,109		probably null	Het
Olfr1191-ps1	A	G	2: 88,643,597	T277A	probably damaging	Het
Olfr390	A	T	11: 73,787,100	H54L	possibly damaging	Het
Paqr9	T	C	9: 95,560,043	S29P	probably benign	Het
Parm1	A	G	5: 91,594,210	T146A	possibly damaging	Het
Pgm1	T	A	5: 64,103,878	F238L	probably benign	Het
Pigv	A	T	4: 133,665,481	F126Y	probably damaging	Het
Pitx2	T	C	3: 129,218,608	M222T	probably damaging	Het
Plekhg6	T	C	6: 125,378,730	N37S	probably benign	Het
Psme4	A	T	11: 30,834,307	K961*	probably null	Het
Rbpj	T	C	5: 53,653,151	W392R	probably damaging	Het
Reg3a	T	A	6: 78,381,055		probably null	Het
Rfc3	C	T	5: 151,648,284	S85N	probably benign	Het
Rtn3	T	C	19: 7,458,331	T80A	probably benign	Het
Sash1	T	C	10: 8,784,221	T195A	probably damaging	Het
Ska1	A	G	18: 74,206,839	V12A	probably benign	Het
Slc25a1	A	G	16: 17,927,430	V80A	probably benign	Het
Slc26a5	A	T	5: 21,834,344	V217D	probably damaging	Het
Slc46a1	A	G	11: 78,466,979	D286G	probably benign	Het
Spata2l	A	T	8: 123,235,558	L88Q	probably damaging	Het
Sptbn1	T	G	11: 30,138,634	Q876P	probably benign	Het
Tenm2	T	A	11: 36,023,580	I2377F	possibly damaging	Het
Thbs4	A	T	13: 92,762,869	D539E	probably damaging	Het
Tmem154	T	A	3: 84,692,506	C162S	possibly damaging	Het
Tpcn1	T	C	5: 120,544,437	E502G	probably benign	Het
Traf7	G	A	17: 24,512,292	R257C	probably benign	Het
Tsc22d2	T	C	3: 58,416,208	Y174H	probably damaging	Het
Usp8	A	G	2: 126,752,310	E802G	probably damaging	Het
Vmn1r5	T	C	6: 56,986,057	V239A	possibly damaging	Het
Vmn2r99	T	A	17: 19,380,195	S494T	possibly damaging	Het
Zbtb38	A	G	9: 96,686,464	F856L	probably damaging	Het

Other mutations in Abca16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Abca16	APN	7	120423759	missense	probably benign	0.08
IGL00590:Abca16	APN	7	120423815	missense	probably damaging	1.00
IGL01320:Abca16	APN	7	120439199	missense	probably damaging	1.00
IGL01322:Abca16	APN	7	120439199	missense	probably damaging	1.00
IGL01613:Abca16	APN	7	120541277	missense	probably benign	0.03
IGL01774:Abca16	APN	7	120477835	missense	probably damaging	1.00
IGL01774:Abca16	APN	7	120421801	splice site	probably benign
IGL01797:Abca16	APN	7	120514537	missense	probably benign	0.15
IGL02406:Abca16	APN	7	120540602	missense	probably damaging	1.00
IGL02437:Abca16	APN	7	120533729	missense	probably benign	0.00
IGL02541:Abca16	APN	7	120514658	missense	possibly damaging	0.91
IGL02576:Abca16	APN	7	120433455	missense	probably benign	0.05
IGL02578:Abca16	APN	7	120423956	critical splice donor site	probably null
IGL03156:Abca16	APN	7	120423851	missense	possibly damaging	0.69
IGL03381:Abca16	APN	7	120527818	missense	probably benign	0.12
PIT4802001:Abca16	UTSW	7	120540128	missense	probably benign	0.31
R0024:Abca16	UTSW	7	120433385	missense	probably damaging	1.00
R0026:Abca16	UTSW	7	120477923	splice site	probably benign
R0026:Abca16	UTSW	7	120477923	splice site	probably benign
R0123:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0134:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0225:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0346:Abca16	UTSW	7	120435932	missense	probably damaging	1.00
R0355:Abca16	UTSW	7	120423798	missense	possibly damaging	0.68
R0358:Abca16	UTSW	7	120544716	missense	probably benign	0.01
R0525:Abca16	UTSW	7	120465810	nonsense	probably null
R0617:Abca16	UTSW	7	120433611	splice site	probably benign
R0625:Abca16	UTSW	7	120435893	missense	probably damaging	1.00
R0835:Abca16	UTSW	7	120465784	missense	probably benign	0.42
R1445:Abca16	UTSW	7	120520033	missense	probably benign	0.41
R1535:Abca16	UTSW	7	120540705	missense	probably benign	0.30
R1567:Abca16	UTSW	7	120431129	missense	probably benign	0.08
R1694:Abca16	UTSW	7	120520084	missense	probably damaging	1.00
R1860:Abca16	UTSW	7	120534763	missense	probably benign	0.02
R1876:Abca16	UTSW	7	120433385	missense	probably damaging	1.00
R1913:Abca16	UTSW	7	120541240	missense	probably benign	0.04
R1940:Abca16	UTSW	7	120433609	splice site	probably benign
R2042:Abca16	UTSW	7	120544718	missense	probably benign
R2115:Abca16	UTSW	7	120540645	missense	probably damaging	1.00
R2122:Abca16	UTSW	7	120519961	missense	probably damaging	1.00
R2265:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2267:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2269:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2993:Abca16	UTSW	7	120535161	missense	probably damaging	1.00
R3055:Abca16	UTSW	7	120435851	missense	probably benign	0.05
R3956:Abca16	UTSW	7	120527752	missense	probably damaging	0.96
R4114:Abca16	UTSW	7	120527067	missense	probably benign	0.06
R4441:Abca16	UTSW	7	120527801	missense	probably benign	0.04
R4601:Abca16	UTSW	7	120436697	missense	probably damaging	0.98
R4706:Abca16	UTSW	7	120465765	missense	probably damaging	1.00
R4807:Abca16	UTSW	7	120540609	missense	probably damaging	1.00
R4824:Abca16	UTSW	7	120475479	missense	possibly damaging	0.86
R4937:Abca16	UTSW	7	120527086	missense	probably damaging	0.98
R5152:Abca16	UTSW	7	120540623	missense	probably benign	0.02
R5257:Abca16	UTSW	7	120436769	critical splice donor site	probably null
R5258:Abca16	UTSW	7	120436769	critical splice donor site	probably null
R5330:Abca16	UTSW	7	120503377	missense	probably benign	0.15
R5388:Abca16	UTSW	7	120540746	critical splice donor site	probably null
R5590:Abca16	UTSW	7	120544772	missense	probably damaging	0.98
R5810:Abca16	UTSW	7	120435932	missense	probably damaging	1.00
R6030:Abca16	UTSW	7	120533798	missense	probably benign
R6030:Abca16	UTSW	7	120533798	missense	probably benign
R6161:Abca16	UTSW	7	120540711	missense	probably damaging	1.00
R6313:Abca16	UTSW	7	120527121	missense	probably damaging	1.00
R6485:Abca16	UTSW	7	120427167	nonsense	probably null
R6527:Abca16	UTSW	7	120477772	missense	possibly damaging	0.95
R6772:Abca16	UTSW	7	120527053	missense	probably damaging	1.00
R6899:Abca16	UTSW	7	120527041	missense	probably damaging	1.00
R6941:Abca16	UTSW	7	120541147	missense	probably damaging	1.00
R6990:Abca16	UTSW	7	120527727	missense	probably benign	0.00
R7059:Abca16	UTSW	7	120421748	missense	probably benign	0.00
R7144:Abca16	UTSW	7	120433573	missense	possibly damaging	0.89
R7146:Abca16	UTSW	7	120527751	missense	possibly damaging	0.46
R7193:Abca16	UTSW	7	120427186	missense	probably damaging	1.00
R7308:Abca16	UTSW	7	120423770	missense	probably benign	0.01
R7449:Abca16	UTSW	7	120435908	missense	possibly damaging	0.95
R7571:Abca16	UTSW	7	120519988	missense	probably benign	0.11
R7617:Abca16	UTSW	7	120503471	nonsense	probably null
R7646:Abca16	UTSW	7	120514714	missense	probably benign	0.04
R7750:Abca16	UTSW	7	120514705	missense	probably benign	0.09
R7763:Abca16	UTSW	7	120514602	missense	probably damaging	1.00
R7840:Abca16	UTSW	7	120475466	missense	probably benign	0.00
R7946:Abca16	UTSW	7	120527175	missense	probably benign	0.01
R8018:Abca16	UTSW	7	120533643	missense	probably benign	0.04
R8170:Abca16	UTSW	7	120465782	missense	probably damaging	1.00
R8413:Abca16	UTSW	7	120423900	missense	probably benign	0.06
R8461:Abca16	UTSW	7	120436695	missense	possibly damaging	0.95
R8858:Abca16	UTSW	7	120453104	missense	probably benign
R8881:Abca16	UTSW	7	120475571	missense	probably benign	0.18
R9272:Abca16	UTSW	7	120477770	missense	probably benign	0.13
R9303:Abca16	UTSW	7	120527766	missense	probably benign	0.25
R9305:Abca16	UTSW	7	120527766	missense	probably benign	0.25
R9320:Abca16	UTSW	7	120540097	missense	probably damaging	0.98
R9413:Abca16	UTSW	7	120527199	missense	probably benign	0.01
R9512:Abca16	UTSW	7	120423740	missense	probably benign	0.01
R9559:Abca16	UTSW	7	120421796	critical splice donor site	probably null
R9615:Abca16	UTSW	7	120527181	missense	probably benign	0.01
R9641:Abca16	UTSW	7	120527085	missense	possibly damaging	0.52
R9643:Abca16	UTSW	7	120465800	missense	possibly damaging	0.96
R9674:Abca16	UTSW	7	120475445	critical splice acceptor site	probably null
R9714:Abca16	UTSW	7	120431160	missense	probably benign	0.01
R9799:Abca16	UTSW	7	120533775	missense	probably benign	0.00
R9800:Abca16	UTSW	7	120520060	missense	possibly damaging	0.68
RF020:Abca16	UTSW	7	120533657	missense	possibly damaging	0.90
X0066:Abca16	UTSW	7	120503386	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TACATGTTGGCTCACTGGC -3'
(R):5'- TGCAATCCATTTACAGGCCTATAG -3'

Sequencing Primer
(F):5'- GATTGTCACACCTTCTGC -3'
(R):5'- TCCATTTACAGGCCTATAGAAGAAG -3'

Posted On

2018-10-18