Incidental Mutation 'R6885:Zbtb38'
ID 536796
Institutional Source Beutler Lab
Gene Symbol Zbtb38
Ensembl Gene ENSMUSG00000040433
Gene Name zinc finger and BTB domain containing 38
Synonyms CIBZ, A930014K01Rik, Zenon homolog
MMRRC Submission 045031-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.450) question?
Stock # R6885 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 96682770-96752831 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96686464 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 856 (F856L)
Ref Sequence ENSEMBL: ENSMUSP00000121753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093798] [ENSMUST00000126066] [ENSMUST00000128269] [ENSMUST00000140121] [ENSMUST00000152594]
AlphaFold Q3LR78
Predicted Effect probably damaging
Transcript: ENSMUST00000093798
AA Change: F856L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091315
Gene: ENSMUSG00000040433
AA Change: F856L

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126066
AA Change: F856L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114300
Gene: ENSMUSG00000040433
AA Change: F856L

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128269
SMART Domains Protein: ENSMUSP00000121871
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140121
SMART Domains Protein: ENSMUSP00000120040
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152594
AA Change: F856L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121753
Gene: ENSMUSG00000040433
AA Change: F856L

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional activator that binds methylated DNA. The encoded protein can form homodimers or heterodimers through the zinc finger domains. In mouse, inhibition of this protein has been associated with apoptosis in some cell types. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,520,109 (GRCm38) I1025M probably benign Het
Adamtsl5 T A 10: 80,343,631 (GRCm38) T164S probably benign Het
Ankar C T 1: 72,643,036 (GRCm38) A1239T unknown Het
Aox4 A T 1: 58,264,378 (GRCm38) S1192C probably damaging Het
Atl2 T C 17: 79,852,553 (GRCm38) D68G probably damaging Het
Btnl4 T C 17: 34,472,945 (GRCm38) I228V probably benign Het
Catsper4 T C 4: 134,215,149 (GRCm38) T231A probably benign Het
Ccl12 A T 11: 82,102,697 (GRCm38) T54S probably damaging Het
Cntn1 T C 15: 92,243,099 (GRCm38) probably null Het
Cog5 T A 12: 31,894,199 (GRCm38) D694E probably damaging Het
Crat T A 2: 30,415,196 (GRCm38) probably benign Het
Crot T C 5: 8,973,635 (GRCm38) T418A probably benign Het
Cubn G A 2: 13,318,278 (GRCm38) P2826L probably damaging Het
Dnah17 A G 11: 118,090,772 (GRCm38) F1698L possibly damaging Het
Dock8 T A 19: 25,147,378 (GRCm38) D1019E possibly damaging Het
Eps15 A G 4: 109,309,164 (GRCm38) N85D probably damaging Het
Exoc1 T C 5: 76,559,042 (GRCm38) S457P probably damaging Het
Ext1 G A 15: 53,101,692 (GRCm38) T426I probably damaging Het
Fat1 T C 8: 44,952,452 (GRCm38) S747P possibly damaging Het
Gas7 A G 11: 67,683,387 (GRCm38) D396G probably damaging Het
Gm13023 T C 4: 143,793,533 (GRCm38) C116R probably damaging Het
Gm5114 G T 7: 39,408,156 (GRCm38) R680S probably benign Het
Gpcpd1 A T 2: 132,554,074 (GRCm38) L94M possibly damaging Het
Gse1 C A 8: 120,229,482 (GRCm38) probably benign Het
Hmgb1 T C 5: 149,050,661 (GRCm38) E26G probably benign Het
Incenp C T 19: 9,875,132 (GRCm38) R714Q unknown Het
Krt73 T C 15: 101,796,398 (GRCm38) E351G probably damaging Het
Ksr1 A G 11: 79,047,295 (GRCm38) probably null Het
Lpin2 T G 17: 71,215,150 (GRCm38) S60A probably damaging Het
Lrrc71 T C 3: 87,742,620 (GRCm38) probably null Het
Mafb A G 2: 160,366,019 (GRCm38) S220P possibly damaging Het
Maml3 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC 3: 51,697,579 (GRCm38) Het
Mcmbp T C 7: 128,725,109 (GRCm38) probably null Het
Olfr1191-ps1 A G 2: 88,643,597 (GRCm38) T277A probably damaging Het
Olfr390 A T 11: 73,787,100 (GRCm38) H54L possibly damaging Het
Paqr9 T C 9: 95,560,043 (GRCm38) S29P probably benign Het
Parm1 A G 5: 91,594,210 (GRCm38) T146A possibly damaging Het
Pgm1 T A 5: 64,103,878 (GRCm38) F238L probably benign Het
Pigv A T 4: 133,665,481 (GRCm38) F126Y probably damaging Het
Pitx2 T C 3: 129,218,608 (GRCm38) M222T probably damaging Het
Plekhg6 T C 6: 125,378,730 (GRCm38) N37S probably benign Het
Psme4 A T 11: 30,834,307 (GRCm38) K961* probably null Het
Rbpj T C 5: 53,653,151 (GRCm38) W392R probably damaging Het
Reg3a T A 6: 78,381,055 (GRCm38) probably null Het
Rfc3 C T 5: 151,648,284 (GRCm38) S85N probably benign Het
Rtn3 T C 19: 7,458,331 (GRCm38) T80A probably benign Het
Sash1 T C 10: 8,784,221 (GRCm38) T195A probably damaging Het
Ska1 A G 18: 74,206,839 (GRCm38) V12A probably benign Het
Slc25a1 A G 16: 17,927,430 (GRCm38) V80A probably benign Het
Slc26a5 A T 5: 21,834,344 (GRCm38) V217D probably damaging Het
Slc46a1 A G 11: 78,466,979 (GRCm38) D286G probably benign Het
Spata2l A T 8: 123,235,558 (GRCm38) L88Q probably damaging Het
Sptbn1 T G 11: 30,138,634 (GRCm38) Q876P probably benign Het
Tenm2 T A 11: 36,023,580 (GRCm38) I2377F possibly damaging Het
Thbs4 A T 13: 92,762,869 (GRCm38) D539E probably damaging Het
Tmem154 T A 3: 84,692,506 (GRCm38) C162S possibly damaging Het
Tpcn1 T C 5: 120,544,437 (GRCm38) E502G probably benign Het
Traf7 G A 17: 24,512,292 (GRCm38) R257C probably benign Het
Tsc22d2 T C 3: 58,416,208 (GRCm38) Y174H probably damaging Het
Usp8 A G 2: 126,752,310 (GRCm38) E802G probably damaging Het
Vmn1r5 T C 6: 56,986,057 (GRCm38) V239A possibly damaging Het
Vmn2r99 T A 17: 19,380,195 (GRCm38) S494T possibly damaging Het
Other mutations in Zbtb38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Zbtb38 APN 9 96,687,494 (GRCm38) missense probably damaging 1.00
IGL01895:Zbtb38 APN 9 96,688,408 (GRCm38) missense probably benign 0.00
IGL02513:Zbtb38 APN 9 96,687,073 (GRCm38) missense probably damaging 1.00
IGL02649:Zbtb38 APN 9 96,686,619 (GRCm38) missense probably damaging 0.96
IGL02938:Zbtb38 APN 9 96,687,174 (GRCm38) missense probably benign 0.11
PIT4131001:Zbtb38 UTSW 9 96,686,316 (GRCm38) missense probably damaging 1.00
R0048:Zbtb38 UTSW 9 96,687,676 (GRCm38) missense probably damaging 1.00
R0152:Zbtb38 UTSW 9 96,686,280 (GRCm38) missense probably damaging 1.00
R0158:Zbtb38 UTSW 9 96,686,940 (GRCm38) missense possibly damaging 0.46
R0519:Zbtb38 UTSW 9 96,685,773 (GRCm38) missense probably damaging 1.00
R0594:Zbtb38 UTSW 9 96,685,954 (GRCm38) missense probably damaging 1.00
R1556:Zbtb38 UTSW 9 96,686,991 (GRCm38) missense probably benign 0.26
R1698:Zbtb38 UTSW 9 96,685,462 (GRCm38) missense probably benign
R1772:Zbtb38 UTSW 9 96,688,041 (GRCm38) missense probably damaging 1.00
R1799:Zbtb38 UTSW 9 96,688,881 (GRCm38) missense probably damaging 1.00
R1837:Zbtb38 UTSW 9 96,686,995 (GRCm38) missense probably benign
R2446:Zbtb38 UTSW 9 96,687,646 (GRCm38) missense probably damaging 1.00
R3153:Zbtb38 UTSW 9 96,688,249 (GRCm38) missense probably benign 0.34
R3950:Zbtb38 UTSW 9 96,687,546 (GRCm38) missense probably damaging 1.00
R4240:Zbtb38 UTSW 9 96,686,102 (GRCm38) small deletion probably benign
R4630:Zbtb38 UTSW 9 96,688,851 (GRCm38) missense probably damaging 1.00
R4666:Zbtb38 UTSW 9 96,688,383 (GRCm38) missense probably damaging 1.00
R4732:Zbtb38 UTSW 9 96,687,684 (GRCm38) missense probably damaging 1.00
R4733:Zbtb38 UTSW 9 96,687,684 (GRCm38) missense probably damaging 1.00
R4824:Zbtb38 UTSW 9 96,688,201 (GRCm38) missense probably benign 0.06
R5006:Zbtb38 UTSW 9 96,685,651 (GRCm38) missense probably damaging 1.00
R5109:Zbtb38 UTSW 9 96,687,009 (GRCm38) missense probably damaging 0.99
R5251:Zbtb38 UTSW 9 96,687,108 (GRCm38) missense probably benign 0.43
R5396:Zbtb38 UTSW 9 96,687,643 (GRCm38) missense probably damaging 1.00
R5659:Zbtb38 UTSW 9 96,687,420 (GRCm38) missense probably damaging 1.00
R6249:Zbtb38 UTSW 9 96,685,992 (GRCm38) missense probably damaging 0.99
R6294:Zbtb38 UTSW 9 96,687,229 (GRCm38) missense probably benign 0.05
R6615:Zbtb38 UTSW 9 96,686,654 (GRCm38) nonsense probably null
R6625:Zbtb38 UTSW 9 96,687,313 (GRCm38) missense probably damaging 1.00
R7304:Zbtb38 UTSW 9 96,687,427 (GRCm38) missense probably damaging 0.96
R7675:Zbtb38 UTSW 9 96,685,541 (GRCm38) missense probably benign 0.00
R7823:Zbtb38 UTSW 9 96,685,976 (GRCm38) nonsense probably null
R7900:Zbtb38 UTSW 9 96,688,936 (GRCm38) missense probably damaging 1.00
R8077:Zbtb38 UTSW 9 96,688,100 (GRCm38) missense probably benign
R8432:Zbtb38 UTSW 9 96,686,238 (GRCm38) missense possibly damaging 0.68
R8802:Zbtb38 UTSW 9 96,685,570 (GRCm38) missense probably benign 0.13
R8930:Zbtb38 UTSW 9 96,686,381 (GRCm38) missense probably benign 0.04
R8932:Zbtb38 UTSW 9 96,686,381 (GRCm38) missense probably benign 0.04
R9008:Zbtb38 UTSW 9 96,687,047 (GRCm38) missense probably benign
R9347:Zbtb38 UTSW 9 96,685,596 (GRCm38) missense probably damaging 0.99
R9520:Zbtb38 UTSW 9 96,686,051 (GRCm38) missense probably damaging 0.99
R9568:Zbtb38 UTSW 9 96,688,891 (GRCm38) missense probably damaging 1.00
R9680:Zbtb38 UTSW 9 96,688,344 (GRCm38) missense probably benign 0.03
R9777:Zbtb38 UTSW 9 96,688,303 (GRCm38) missense probably damaging 0.96
R9777:Zbtb38 UTSW 9 96,688,302 (GRCm38) missense possibly damaging 0.49
R9790:Zbtb38 UTSW 9 96,688,647 (GRCm38) missense probably damaging 1.00
R9791:Zbtb38 UTSW 9 96,688,647 (GRCm38) missense probably damaging 1.00
X0066:Zbtb38 UTSW 9 96,687,612 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTATCAGTGGAGTCCTGG -3'
(R):5'- AAACTGCTCCGAGTAACAGGG -3'

Sequencing Primer
(F):5'- ATCAGTGGAGTCCTGGTCACTC -3'
(R):5'- AATATATTGCTGATCACGGAGGGTC -3'
Posted On 2018-10-18