Mutagenetix > Incidental Mutation

Incidental Mutation 'R6885:Sash1'

536797

Institutional Source

Beutler Lab

Gene Symbol

Sash1

Ensembl Gene

ENSMUSG00000015305

Gene Name

SAM and SH3 domain containing 1

Synonyms

MMRRC Submission

045031-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6885 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8722219-8886070 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8784221 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 195 (T195A)

Ref Sequence

ENSEMBL: ENSMUSP00000015449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015449]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000015449
AA Change: T195A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: T195A

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
coiled coil region	185	212	N/A	INTRINSIC
low complexity region	323	336	N/A	INTRINSIC
Pfam:SLY	394	548	1.2e-46	PFAM
SH3	550	607	1.16e-3	SMART
SAM	623	690	1.83e-11	SMART
low complexity region	1008	1021	N/A	INTRINSIC
SAM	1157	1224	3.6e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	G	7: 120,520,109	I1025M	probably benign	Het
Adamtsl5	T	A	10: 80,343,631	T164S	probably benign	Het
Ankar	C	T	1: 72,643,036	A1239T	unknown	Het
Aox4	A	T	1: 58,264,378	S1192C	probably damaging	Het
Atl2	T	C	17: 79,852,553	D68G	probably damaging	Het
Btnl4	T	C	17: 34,472,945	I228V	probably benign	Het
Catsper4	T	C	4: 134,215,149	T231A	probably benign	Het
Ccl12	A	T	11: 82,102,697	T54S	probably damaging	Het
Cntn1	T	C	15: 92,243,099		probably null	Het
Cog5	T	A	12: 31,894,199	D694E	probably damaging	Het
Crat	T	A	2: 30,415,196		probably benign	Het
Crot	T	C	5: 8,973,635	T418A	probably benign	Het
Cubn	G	A	2: 13,318,278	P2826L	probably damaging	Het
Dnah17	A	G	11: 118,090,772	F1698L	possibly damaging	Het
Dock8	T	A	19: 25,147,378	D1019E	possibly damaging	Het
Eps15	A	G	4: 109,309,164	N85D	probably damaging	Het
Exoc1	T	C	5: 76,559,042	S457P	probably damaging	Het
Ext1	G	A	15: 53,101,692	T426I	probably damaging	Het
Fat1	T	C	8: 44,952,452	S747P	possibly damaging	Het
Gas7	A	G	11: 67,683,387	D396G	probably damaging	Het
Gm13023	T	C	4: 143,793,533	C116R	probably damaging	Het
Gm5114	G	T	7: 39,408,156	R680S	probably benign	Het
Gpcpd1	A	T	2: 132,554,074	L94M	possibly damaging	Het
Gse1	C	A	8: 120,229,482		probably benign	Het
Hmgb1	T	C	5: 149,050,661	E26G	probably benign	Het
Incenp	C	T	19: 9,875,132	R714Q	unknown	Het
Krt73	T	C	15: 101,796,398	E351G	probably damaging	Het
Ksr1	A	G	11: 79,047,295		probably null	Het
Lpin2	T	G	17: 71,215,150	S60A	probably damaging	Het
Lrrc71	T	C	3: 87,742,620		probably null	Het
Mafb	A	G	2: 160,366,019	S220P	possibly damaging	Het
Maml3	TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC	TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC	3: 51,697,579			Het
Mcmbp	T	C	7: 128,725,109		probably null	Het
Olfr1191-ps1	A	G	2: 88,643,597	T277A	probably damaging	Het
Olfr390	A	T	11: 73,787,100	H54L	possibly damaging	Het
Paqr9	T	C	9: 95,560,043	S29P	probably benign	Het
Parm1	A	G	5: 91,594,210	T146A	possibly damaging	Het
Pgm1	T	A	5: 64,103,878	F238L	probably benign	Het
Pigv	A	T	4: 133,665,481	F126Y	probably damaging	Het
Pitx2	T	C	3: 129,218,608	M222T	probably damaging	Het
Plekhg6	T	C	6: 125,378,730	N37S	probably benign	Het
Psme4	A	T	11: 30,834,307	K961*	probably null	Het
Rbpj	T	C	5: 53,653,151	W392R	probably damaging	Het
Reg3a	T	A	6: 78,381,055		probably null	Het
Rfc3	C	T	5: 151,648,284	S85N	probably benign	Het
Rtn3	T	C	19: 7,458,331	T80A	probably benign	Het
Ska1	A	G	18: 74,206,839	V12A	probably benign	Het
Slc25a1	A	G	16: 17,927,430	V80A	probably benign	Het
Slc26a5	A	T	5: 21,834,344	V217D	probably damaging	Het
Slc46a1	A	G	11: 78,466,979	D286G	probably benign	Het
Spata2l	A	T	8: 123,235,558	L88Q	probably damaging	Het
Sptbn1	T	G	11: 30,138,634	Q876P	probably benign	Het
Tenm2	T	A	11: 36,023,580	I2377F	possibly damaging	Het
Thbs4	A	T	13: 92,762,869	D539E	probably damaging	Het
Tmem154	T	A	3: 84,692,506	C162S	possibly damaging	Het
Tpcn1	T	C	5: 120,544,437	E502G	probably benign	Het
Traf7	G	A	17: 24,512,292	R257C	probably benign	Het
Tsc22d2	T	C	3: 58,416,208	Y174H	probably damaging	Het
Usp8	A	G	2: 126,752,310	E802G	probably damaging	Het
Vmn1r5	T	C	6: 56,986,057	V239A	possibly damaging	Het
Vmn2r99	T	A	17: 19,380,195	S494T	possibly damaging	Het
Zbtb38	A	G	9: 96,686,464	F856L	probably damaging	Het

Other mutations in Sash1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Sash1	APN	10	8751413	missense	probably damaging	1.00
IGL01535:Sash1	APN	10	8741577	missense	probably damaging	1.00
IGL01537:Sash1	APN	10	8729658	missense	probably damaging	1.00
IGL01788:Sash1	APN	10	8733646	missense	probably benign	0.01
IGL01933:Sash1	APN	10	8751133	missense	probably damaging	0.99
IGL02126:Sash1	APN	10	8739465	missense	probably damaging	0.96
IGL02285:Sash1	APN	10	8740334	missense	probably damaging	0.99
IGL02400:Sash1	APN	10	8733647	nonsense	probably null
IGL02504:Sash1	APN	10	8729912	missense	probably benign	0.00
IGL02630:Sash1	APN	10	8744535	missense	probably benign	0.06
boyscout	UTSW	10	8742422	splice site	probably null
cubscout	UTSW	10	8729713	missense	probably benign	0.01
R0592:Sash1	UTSW	10	8729782	missense	probably benign	0.00
R0647:Sash1	UTSW	10	8729552	missense	probably damaging	0.99
R0656:Sash1	UTSW	10	8751137	critical splice donor site	probably null
R0830:Sash1	UTSW	10	8729909	missense	probably benign	0.01
R0919:Sash1	UTSW	10	8730079	missense	probably benign	0.01
R1470:Sash1	UTSW	10	8789593	missense	probably damaging	1.00
R1470:Sash1	UTSW	10	8789593	missense	probably damaging	1.00
R1606:Sash1	UTSW	10	8729957	missense	probably benign	0.00
R1707:Sash1	UTSW	10	8730377	missense	probably benign	0.00
R1922:Sash1	UTSW	10	8727908	missense	possibly damaging	0.62
R1940:Sash1	UTSW	10	8729932	missense	probably benign
R1964:Sash1	UTSW	10	8729713	missense	probably benign	0.01
R2013:Sash1	UTSW	10	8729413	missense	probably benign	0.03
R2014:Sash1	UTSW	10	8729413	missense	probably benign	0.03
R2015:Sash1	UTSW	10	8729413	missense	probably benign	0.03
R2074:Sash1	UTSW	10	8756697	missense	probably damaging	1.00
R2252:Sash1	UTSW	10	8729977	missense	probably benign	0.01
R2253:Sash1	UTSW	10	8729977	missense	probably benign	0.01
R2260:Sash1	UTSW	10	8786378	nonsense	probably null
R3085:Sash1	UTSW	10	8742422	splice site	probably null
R4024:Sash1	UTSW	10	8729917	missense	probably benign	0.00
R4039:Sash1	UTSW	10	8729627	missense	probably damaging	1.00
R4290:Sash1	UTSW	10	8730242	missense	possibly damaging	0.59
R4292:Sash1	UTSW	10	8730242	missense	possibly damaging	0.59
R4295:Sash1	UTSW	10	8730242	missense	possibly damaging	0.59
R4301:Sash1	UTSW	10	8751470	missense	probably benign	0.00
R4657:Sash1	UTSW	10	8725660	missense	probably damaging	1.00
R4669:Sash1	UTSW	10	8730385	missense	probably benign	0.00
R4719:Sash1	UTSW	10	8729713	missense	probably benign	0.01
R4745:Sash1	UTSW	10	8729908	missense	probably benign
R5197:Sash1	UTSW	10	8740225	missense	probably damaging	1.00
R5217:Sash1	UTSW	10	8780604	missense	possibly damaging	0.63
R5420:Sash1	UTSW	10	8746186	missense	probably damaging	1.00
R5591:Sash1	UTSW	10	8725718	missense	probably benign	0.36
R6505:Sash1	UTSW	10	8729527	missense	probably benign	0.21
R6679:Sash1	UTSW	10	8740185	missense	probably damaging	1.00
R6761:Sash1	UTSW	10	8744522	missense	probably damaging	0.99
R6980:Sash1	UTSW	10	8729848	missense	probably benign	0.00
R7034:Sash1	UTSW	10	8730083	nonsense	probably null
R7036:Sash1	UTSW	10	8730083	nonsense	probably null
R7088:Sash1	UTSW	10	8729717	nonsense	probably null
R7289:Sash1	UTSW	10	8730196	missense	probably damaging	0.99
R7464:Sash1	UTSW	10	8756745	missense	possibly damaging	0.82
R7661:Sash1	UTSW	10	8729391	missense	probably benign	0.01
R7752:Sash1	UTSW	10	8780564	nonsense	probably null
R7856:Sash1	UTSW	10	8729708	missense	probably benign	0.00
R7901:Sash1	UTSW	10	8780564	nonsense	probably null
R8152:Sash1	UTSW	10	8751041	missense	possibly damaging	0.94
R8218:Sash1	UTSW	10	8751236	missense	probably damaging	0.99
R8317:Sash1	UTSW	10	8729386	missense	possibly damaging	0.76
R8358:Sash1	UTSW	10	8729981	missense	probably benign
R8503:Sash1	UTSW	10	8780513	splice site	probably benign
R8696:Sash1	UTSW	10	8733695	missense	probably damaging	1.00
R8703:Sash1	UTSW	10	8729831	missense	probably damaging	0.99
R8710:Sash1	UTSW	10	8780521	missense	possibly damaging	0.82
R8822:Sash1	UTSW	10	8885871	start gained	probably benign
R8826:Sash1	UTSW	10	8762105	start codon destroyed	probably null
R8891:Sash1	UTSW	10	8727970	missense	probably damaging	1.00
R8968:Sash1	UTSW	10	8730415	missense	probably benign	0.00
R8984:Sash1	UTSW	10	8751044	missense	possibly damaging	0.46
R9194:Sash1	UTSW	10	8740205	missense	probably damaging	0.99
R9248:Sash1	UTSW	10	8741532	missense	probably damaging	1.00
R9405:Sash1	UTSW	10	8762230	start gained	probably benign
R9408:Sash1	UTSW	10	8762230	start gained	probably benign
R9489:Sash1	UTSW	10	8729405	missense	probably benign	0.05
R9576:Sash1	UTSW	10	8744535	missense	probably benign	0.06
R9632:Sash1	UTSW	10	8740205	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAGTCTGCTGGATTTTCCTC -3'
(R):5'- GAGAAACGTCCCTCCTTCAC -3'

Sequencing Primer
(F):5'- TGCTGGGGCATACACAAG -3'
(R):5'- CCCAAACTGAGGGGCTTC -3'

Posted On

2018-10-18