Mutagenetix > Incidental Mutation

Incidental Mutation 'R6885:Psme4'

536800

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6885 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 30834307 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 961 (K961*)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably null
Transcript: ENSMUST00000041231
AA Change: K961*

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: K961*

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	G	7: 120,520,109	I1025M	probably benign	Het
Adamtsl5	T	A	10: 80,343,631	T164S	probably benign	Het
Ankar	C	T	1: 72,643,036	A1239T	unknown	Het
Aox4	A	T	1: 58,264,378	S1192C	probably damaging	Het
Atl2	T	C	17: 79,852,553	D68G	probably damaging	Het
Btnl4	T	C	17: 34,472,945	I228V	probably benign	Het
Catsper4	T	C	4: 134,215,149	T231A	probably benign	Het
Ccl12	A	T	11: 82,102,697	T54S	probably damaging	Het
Cntn1	T	C	15: 92,243,099		probably null	Het
Cog5	T	A	12: 31,894,199	D694E	probably damaging	Het
Crat	T	A	2: 30,415,196		probably benign	Het
Crot	T	C	5: 8,973,635	T418A	probably benign	Het
Cubn	G	A	2: 13,318,278	P2826L	probably damaging	Het
Dnah17	A	G	11: 118,090,772	F1698L	possibly damaging	Het
Dock8	T	A	19: 25,147,378	D1019E	possibly damaging	Het
Eps15	A	G	4: 109,309,164	N85D	probably damaging	Het
Exoc1	T	C	5: 76,559,042	S457P	probably damaging	Het
Ext1	G	A	15: 53,101,692	T426I	probably damaging	Het
Fat1	T	C	8: 44,952,452	S747P	possibly damaging	Het
Gas7	A	G	11: 67,683,387	D396G	probably damaging	Het
Gm13023	T	C	4: 143,793,533	C116R	probably damaging	Het
Gm5114	G	T	7: 39,408,156	R680S	probably benign	Het
Gpcpd1	A	T	2: 132,554,074	L94M	possibly damaging	Het
Gse1	C	A	8: 120,229,482		probably benign	Het
Hmgb1	T	C	5: 149,050,661	E26G	probably benign	Het
Incenp	C	T	19: 9,875,132	R714Q	unknown	Het
Krt73	T	C	15: 101,796,398	E351G	probably damaging	Het
Ksr1	A	G	11: 79,047,295		probably null	Het
Lpin2	T	G	17: 71,215,150	S60A	probably damaging	Het
Lrrc71	T	C	3: 87,742,620		probably null	Het
Mafb	A	G	2: 160,366,019	S220P	possibly damaging	Het
Maml3	TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC	TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC	3: 51,697,579			Het
Mcmbp	T	C	7: 128,725,109		probably null	Het
Olfr1191-ps1	A	G	2: 88,643,597	T277A	probably damaging	Het
Olfr390	A	T	11: 73,787,100	H54L	possibly damaging	Het
Paqr9	T	C	9: 95,560,043	S29P	probably benign	Het
Parm1	A	G	5: 91,594,210	T146A	possibly damaging	Het
Pgm1	T	A	5: 64,103,878	F238L	probably benign	Het
Pigv	A	T	4: 133,665,481	F126Y	probably damaging	Het
Pitx2	T	C	3: 129,218,608	M222T	probably damaging	Het
Plekhg6	T	C	6: 125,378,730	N37S	probably benign	Het
Rbpj	T	C	5: 53,653,151	W392R	probably damaging	Het
Reg3a	T	A	6: 78,381,055		probably null	Het
Rfc3	C	T	5: 151,648,284	S85N	probably benign	Het
Rtn3	T	C	19: 7,458,331	T80A	probably benign	Het
Sash1	T	C	10: 8,784,221	T195A	probably damaging	Het
Ska1	A	G	18: 74,206,839	V12A	probably benign	Het
Slc25a1	A	G	16: 17,927,430	V80A	probably benign	Het
Slc26a5	A	T	5: 21,834,344	V217D	probably damaging	Het
Slc46a1	A	G	11: 78,466,979	D286G	probably benign	Het
Spata2l	A	T	8: 123,235,558	L88Q	probably damaging	Het
Sptbn1	T	G	11: 30,138,634	Q876P	probably benign	Het
Tenm2	T	A	11: 36,023,580	I2377F	possibly damaging	Het
Thbs4	A	T	13: 92,762,869	D539E	probably damaging	Het
Tmem154	T	A	3: 84,692,506	C162S	possibly damaging	Het
Tpcn1	T	C	5: 120,544,437	E502G	probably benign	Het
Traf7	G	A	17: 24,512,292	R257C	probably benign	Het
Tsc22d2	T	C	3: 58,416,208	Y174H	probably damaging	Het
Usp8	A	G	2: 126,752,310	E802G	probably damaging	Het
Vmn1r5	T	C	6: 56,986,057	V239A	possibly damaging	Het
Vmn2r99	T	A	17: 19,380,195	S494T	possibly damaging	Het
Zbtb38	A	G	9: 96,686,464	F856L	probably damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACAGAGTGATGCTGCAGC -3'
(R):5'- TGCACACTAAGGCAAGATTTCAATC -3'

Sequencing Primer
(F):5'- GCATGAGGCAAGTATCTTAATAGTC -3'
(R):5'- AAAGGTATTTCTAATGTCATTGGGG -3'

Posted On

2018-10-18