Incidental Mutation 'R6885:Gas7'
ID536802
Institutional Source Beutler Lab
Gene Symbol Gas7
Ensembl Gene ENSMUSG00000033066
Gene Namegrowth arrest specific 7
SynonymsB230343A10Rik, Gas7-cb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6885 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67455437-67688990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67683387 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 396 (D396G)
Ref Sequence ENSEMBL: ENSMUSP00000104322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021289] [ENSMUST00000041611] [ENSMUST00000108680] [ENSMUST00000108681] [ENSMUST00000108682]
Predicted Effect probably benign
Transcript: ENSMUST00000021289
SMART Domains Protein: ENSMUSP00000021289
Gene: ENSMUSG00000049928

DomainStartEndE-ValueType
Pfam:7tm_2 17 225 4.8e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041611
AA Change: D392G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038420
Gene: ENSMUSG00000033066
AA Change: D392G

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108680
AA Change: D392G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104320
Gene: ENSMUSG00000033066
AA Change: D392G

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108681
AA Change: D392G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104321
Gene: ENSMUSG00000033066
AA Change: D392G

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108682
AA Change: D396G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104322
Gene: ENSMUSG00000033066
AA Change: D396G

DomainStartEndE-ValueType
WW 18 50 1.39e-11 SMART
FCH 150 236 6.62e-25 SMART
coiled coil region 264 308 N/A INTRINSIC
low complexity region 339 358 N/A INTRINSIC
Meta Mutation Damage Score 0.5873 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Growth arrest-specific 7 is expressed primarily in terminally differentiated brain cells and predominantly in mature cerebellar Purkinje neurons. GAS7 plays a putative role in neuronal development. Several transcript variants encoding proteins which vary in the N-terminus have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aged mice homozygous for a hypomorphic allele show impaired coordination, decreased grip strength, decreased motor neuron number, muscle weakness, abnormal skeletal muscle fiber type ratio in the soleus muscle, and defects in motor neuron axon terminal sprouting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,520,109 I1025M probably benign Het
Adamtsl5 T A 10: 80,343,631 T164S probably benign Het
Ankar C T 1: 72,643,036 A1239T unknown Het
Aox4 A T 1: 58,264,378 S1192C probably damaging Het
Atl2 T C 17: 79,852,553 D68G probably damaging Het
Btnl4 T C 17: 34,472,945 I228V probably benign Het
Catsper4 T C 4: 134,215,149 T231A probably benign Het
Ccl12 A T 11: 82,102,697 T54S probably damaging Het
Cntn1 T C 15: 92,243,099 probably null Het
Cog5 T A 12: 31,894,199 D694E probably damaging Het
Crat T A 2: 30,415,196 probably benign Het
Crot T C 5: 8,973,635 T418A probably benign Het
Cubn G A 2: 13,318,278 P2826L probably damaging Het
Dnah17 A G 11: 118,090,772 F1698L possibly damaging Het
Dock8 T A 19: 25,147,378 D1019E possibly damaging Het
Eps15 A G 4: 109,309,164 N85D probably damaging Het
Exoc1 T C 5: 76,559,042 S457P probably damaging Het
Ext1 G A 15: 53,101,692 T426I probably damaging Het
Fat1 T C 8: 44,952,452 S747P possibly damaging Het
Gm13023 T C 4: 143,793,533 C116R probably damaging Het
Gm5114 G T 7: 39,408,156 R680S probably benign Het
Gpcpd1 A T 2: 132,554,074 L94M possibly damaging Het
Gse1 C A 8: 120,229,482 probably benign Het
Hmgb1 T C 5: 149,050,661 E26G probably benign Het
Incenp C T 19: 9,875,132 R714Q unknown Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Ksr1 A G 11: 79,047,295 probably null Het
Lpin2 T G 17: 71,215,150 S60A probably damaging Het
Lrrc71 T C 3: 87,742,620 probably null Het
Mafb A G 2: 160,366,019 S220P possibly damaging Het
Maml3 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC 3: 51,697,579 Het
Mcmbp T C 7: 128,725,109 probably null Het
Olfr1191-ps1 A G 2: 88,643,597 T277A probably damaging Het
Olfr390 A T 11: 73,787,100 H54L possibly damaging Het
Paqr9 T C 9: 95,560,043 S29P probably benign Het
Parm1 A G 5: 91,594,210 T146A possibly damaging Het
Pgm1 T A 5: 64,103,878 F238L probably benign Het
Pigv A T 4: 133,665,481 F126Y probably damaging Het
Pitx2 T C 3: 129,218,608 M222T probably damaging Het
Plekhg6 T C 6: 125,378,730 N37S probably benign Het
Psme4 A T 11: 30,834,307 K961* probably null Het
Rbpj T C 5: 53,653,151 W392R probably damaging Het
Reg3a T A 6: 78,381,055 probably null Het
Rfc3 C T 5: 151,648,284 S85N probably benign Het
Rtn3 T C 19: 7,458,331 T80A probably benign Het
Sash1 T C 10: 8,784,221 T195A probably damaging Het
Ska1 A G 18: 74,206,839 V12A probably benign Het
Slc25a1 A G 16: 17,927,430 V80A probably benign Het
Slc26a5 A T 5: 21,834,344 V217D probably damaging Het
Slc46a1 A G 11: 78,466,979 D286G probably benign Het
Spata2l A T 8: 123,235,558 L88Q probably damaging Het
Sptbn1 T G 11: 30,138,634 Q876P probably benign Het
Tenm2 T A 11: 36,023,580 I2377F possibly damaging Het
Thbs4 A T 13: 92,762,869 D539E probably damaging Het
Tmem154 T A 3: 84,692,506 C162S possibly damaging Het
Tpcn1 T C 5: 120,544,437 E502G probably benign Het
Traf7 G A 17: 24,512,292 R257C probably benign Het
Tsc22d2 T C 3: 58,416,208 Y174H probably damaging Het
Usp8 A G 2: 126,752,310 E802G probably damaging Het
Vmn1r5 T C 6: 56,986,057 V239A possibly damaging Het
Vmn2r99 T A 17: 19,380,195 S494T possibly damaging Het
Zbtb38 A G 9: 96,686,464 F856L probably damaging Het
Other mutations in Gas7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Gas7 APN 11 67652914 critical splice donor site probably null
IGL01634:Gas7 APN 11 67674231 splice site probably benign
IGL02215:Gas7 APN 11 67643332 missense probably benign 0.33
IGL02338:Gas7 APN 11 67682731 missense probably damaging 0.99
IGL02547:Gas7 APN 11 67665435 missense probably damaging 0.99
IGL02679:Gas7 APN 11 67675727 splice site probably null
IGL02959:Gas7 APN 11 67674235 splice site probably benign
R0029:Gas7 UTSW 11 67643337 missense probably benign 0.05
R0335:Gas7 UTSW 11 67662052 missense possibly damaging 0.84
R0931:Gas7 UTSW 11 67652925 splice site probably benign
R1165:Gas7 UTSW 11 67670686 splice site probably benign
R1459:Gas7 UTSW 11 67662076 missense probably damaging 1.00
R2425:Gas7 UTSW 11 67643295 missense probably benign 0.00
R4953:Gas7 UTSW 11 67660050 missense possibly damaging 0.69
R4969:Gas7 UTSW 11 67683408 missense probably damaging 0.98
R5327:Gas7 UTSW 11 67662090 missense probably damaging 1.00
R6145:Gas7 UTSW 11 67629612 missense probably damaging 1.00
R6631:Gas7 UTSW 11 67674281 missense probably damaging 1.00
R6914:Gas7 UTSW 11 67660151 intron probably null
R6942:Gas7 UTSW 11 67660151 intron probably null
Predicted Primers PCR Primer
(F):5'- GAGCCCTGGAACCTTCTAGAAAG -3'
(R):5'- ATGGCCTGGAAATACTGGGG -3'

Sequencing Primer
(F):5'- CTTCTAGAAAGGGTGATCTGAGG -3'
(R):5'- CCTGGAAATACTGGGGAGTCC -3'
Posted On2018-10-18