Mutagenetix > Incidental Mutation

Incidental Mutation 'R6885:Incenp'

536821

Institutional Source

Beutler Lab

Gene Symbol

Incenp

Ensembl Gene

ENSMUSG00000024660

Gene Name

inner centromere protein

Synonyms

2700067E22Rik

MMRRC Submission

045031-MU

Accession Numbers

Genbank: NM_016692

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6885 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

9872297-9899533 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 9875132 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 714 (R714Q)

Ref Sequence

ENSEMBL: ENSMUSP00000025562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025562]

AlphaFold

Q9WU62

Predicted Effect

unknown
Transcript: ENSMUST00000025562
AA Change: R714Q

SMART Domains

Protein: ENSMUSP00000025562
Gene: ENSMUSG00000024660
AA Change: R714Q

Domain	Start	End	E-Value	Type
Pfam:INCENP_N	6	41	1.9e-18	PFAM
low complexity region	83	94	N/A	INTRINSIC
low complexity region	123	145	N/A	INTRINSIC
low complexity region	308	314	N/A	INTRINSIC
low complexity region	350	367	N/A	INTRINSIC
low complexity region	434	447	N/A	INTRINSIC
low complexity region	517	553	N/A	INTRINSIC
low complexity region	557	573	N/A	INTRINSIC
SCOP:d1f5na1	631	739	7e-3	SMART
Pfam:INCENP_ARK-bind	789	846	1.5e-22	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mammalian cells, 2 broad groups of centromere-interacting proteins have been described: constitutively binding centromere proteins and 'passenger,' or transiently interacting, proteins (reviewed by Choo, 1997). The constitutive proteins include CENPA (centromere protein A; MIM 117139), CENPB (MIM 117140), CENPC1 (MIM 117141), and CENPD (MIM 117142). The term 'passenger proteins' encompasses a broad collection of proteins that localize to the centromere during specific stages of the cell cycle (Earnshaw and Mackay, 1994 [PubMed 8088460]). These include CENPE (MIM 117143); MCAK (MIM 604538); KID (MIM 603213); cytoplasmic dynein (e.g., MIM 600112); CliPs (e.g., MIM 179838); and CENPF/mitosin (MIM 600236). The inner centromere proteins (INCENPs) (Earnshaw and Cooke, 1991 [PubMed 1860899]), the initial members of the passenger protein group, display a broad localization along chromosomes in the early stages of mitosis but gradually become concentrated at centromeres as the cell cycle progresses into mid-metaphase. During telophase, the proteins are located within the midbody in the intercellular bridge, where they are discarded after cytokinesis (Cutts et al., 1999 [PubMed 10369859]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant embryos die before E8.5. Embryonic cells exhibit abnormal nuclei and abberent mitosis. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	G	7: 120,520,109	I1025M	probably benign	Het
Adamtsl5	T	A	10: 80,343,631	T164S	probably benign	Het
Ankar	C	T	1: 72,643,036	A1239T	unknown	Het
Aox4	A	T	1: 58,264,378	S1192C	probably damaging	Het
Atl2	T	C	17: 79,852,553	D68G	probably damaging	Het
Btnl4	T	C	17: 34,472,945	I228V	probably benign	Het
Catsper4	T	C	4: 134,215,149	T231A	probably benign	Het
Ccl12	A	T	11: 82,102,697	T54S	probably damaging	Het
Cntn1	T	C	15: 92,243,099		probably null	Het
Cog5	T	A	12: 31,894,199	D694E	probably damaging	Het
Crat	T	A	2: 30,415,196		probably benign	Het
Crot	T	C	5: 8,973,635	T418A	probably benign	Het
Cubn	G	A	2: 13,318,278	P2826L	probably damaging	Het
Dnah17	A	G	11: 118,090,772	F1698L	possibly damaging	Het
Dock8	T	A	19: 25,147,378	D1019E	possibly damaging	Het
Eps15	A	G	4: 109,309,164	N85D	probably damaging	Het
Exoc1	T	C	5: 76,559,042	S457P	probably damaging	Het
Ext1	G	A	15: 53,101,692	T426I	probably damaging	Het
Fat1	T	C	8: 44,952,452	S747P	possibly damaging	Het
Gas7	A	G	11: 67,683,387	D396G	probably damaging	Het
Gm13023	T	C	4: 143,793,533	C116R	probably damaging	Het
Gm5114	G	T	7: 39,408,156	R680S	probably benign	Het
Gpcpd1	A	T	2: 132,554,074	L94M	possibly damaging	Het
Gse1	C	A	8: 120,229,482		probably benign	Het
Hmgb1	T	C	5: 149,050,661	E26G	probably benign	Het
Krt73	T	C	15: 101,796,398	E351G	probably damaging	Het
Ksr1	A	G	11: 79,047,295		probably null	Het
Lpin2	T	G	17: 71,215,150	S60A	probably damaging	Het
Lrrc71	T	C	3: 87,742,620		probably null	Het
Mafb	A	G	2: 160,366,019	S220P	possibly damaging	Het
Maml3	TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC	TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC	3: 51,697,579			Het
Mcmbp	T	C	7: 128,725,109		probably null	Het
Olfr1191-ps1	A	G	2: 88,643,597	T277A	probably damaging	Het
Olfr390	A	T	11: 73,787,100	H54L	possibly damaging	Het
Paqr9	T	C	9: 95,560,043	S29P	probably benign	Het
Parm1	A	G	5: 91,594,210	T146A	possibly damaging	Het
Pgm1	T	A	5: 64,103,878	F238L	probably benign	Het
Pigv	A	T	4: 133,665,481	F126Y	probably damaging	Het
Pitx2	T	C	3: 129,218,608	M222T	probably damaging	Het
Plekhg6	T	C	6: 125,378,730	N37S	probably benign	Het
Psme4	A	T	11: 30,834,307	K961*	probably null	Het
Rbpj	T	C	5: 53,653,151	W392R	probably damaging	Het
Reg3a	T	A	6: 78,381,055		probably null	Het
Rfc3	C	T	5: 151,648,284	S85N	probably benign	Het
Rtn3	T	C	19: 7,458,331	T80A	probably benign	Het
Sash1	T	C	10: 8,784,221	T195A	probably damaging	Het
Ska1	A	G	18: 74,206,839	V12A	probably benign	Het
Slc25a1	A	G	16: 17,927,430	V80A	probably benign	Het
Slc26a5	A	T	5: 21,834,344	V217D	probably damaging	Het
Slc46a1	A	G	11: 78,466,979	D286G	probably benign	Het
Spata2l	A	T	8: 123,235,558	L88Q	probably damaging	Het
Sptbn1	T	G	11: 30,138,634	Q876P	probably benign	Het
Tenm2	T	A	11: 36,023,580	I2377F	possibly damaging	Het
Thbs4	A	T	13: 92,762,869	D539E	probably damaging	Het
Tmem154	T	A	3: 84,692,506	C162S	possibly damaging	Het
Tpcn1	T	C	5: 120,544,437	E502G	probably benign	Het
Traf7	G	A	17: 24,512,292	R257C	probably benign	Het
Tsc22d2	T	C	3: 58,416,208	Y174H	probably damaging	Het
Usp8	A	G	2: 126,752,310	E802G	probably damaging	Het
Vmn1r5	T	C	6: 56,986,057	V239A	possibly damaging	Het
Vmn2r99	T	A	17: 19,380,195	S494T	possibly damaging	Het
Zbtb38	A	G	9: 96,686,464	F856L	probably damaging	Het

Other mutations in Incenp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01324:Incenp	APN	19	9883728	missense	unknown
IGL01717:Incenp	APN	19	9893265	splice site	probably benign
IGL02485:Incenp	APN	19	9893368	missense	unknown
IGL02488:Incenp	APN	19	9893407	missense	unknown
B5639:Incenp	UTSW	19	9893818	missense	unknown
R0060:Incenp	UTSW	19	9885459	splice site	probably benign
R0164:Incenp	UTSW	19	9894879	missense	probably benign	0.23
R0164:Incenp	UTSW	19	9894879	missense	probably benign	0.23
R0242:Incenp	UTSW	19	9893750	missense	unknown
R0242:Incenp	UTSW	19	9893750	missense	unknown
R0284:Incenp	UTSW	19	9893993	missense	unknown
R1264:Incenp	UTSW	19	9884015	missense	unknown
R1432:Incenp	UTSW	19	9885526	missense	unknown
R1679:Incenp	UTSW	19	9895414	missense	unknown
R1827:Incenp	UTSW	19	9872729	missense	possibly damaging	0.94
R1970:Incenp	UTSW	19	9885487	missense	unknown
R3082:Incenp	UTSW	19	9883779	missense	unknown
R3083:Incenp	UTSW	19	9883779	missense	unknown
R4062:Incenp	UTSW	19	9883778	missense	unknown
R4063:Incenp	UTSW	19	9883778	missense	unknown
R4534:Incenp	UTSW	19	9883939	missense	unknown
R4535:Incenp	UTSW	19	9883939	missense	unknown
R4536:Incenp	UTSW	19	9883939	missense	unknown
R4709:Incenp	UTSW	19	9876600	missense	unknown
R4785:Incenp	UTSW	19	9877690	missense	unknown
R4785:Incenp	UTSW	19	9877691	missense	unknown
R5179:Incenp	UTSW	19	9894909	missense	unknown
R5282:Incenp	UTSW	19	9878406	missense	unknown
R5400:Incenp	UTSW	19	9877675	critical splice donor site	probably null
R5502:Incenp	UTSW	19	9893364	missense	unknown
R5608:Incenp	UTSW	19	9893868	small insertion	probably benign
R6033:Incenp	UTSW	19	9872697	missense	probably damaging	0.99
R6033:Incenp	UTSW	19	9872697	missense	probably damaging	0.99
R6807:Incenp	UTSW	19	9877756	missense	unknown
R6959:Incenp	UTSW	19	9876770	missense	unknown
R7033:Incenp	UTSW	19	9893372	missense	unknown
R8258:Incenp	UTSW	19	9893629	missense	unknown
R8258:Incenp	UTSW	19	9893641	missense	unknown
R8259:Incenp	UTSW	19	9893629	missense	unknown
R8259:Incenp	UTSW	19	9893641	missense	unknown
R8293:Incenp	UTSW	19	9875133	nonsense	probably null
R9005:Incenp	UTSW	19	9877724	nonsense	probably null
R9491:Incenp	UTSW	19	9876777	missense	unknown
R9665:Incenp	UTSW	19	9893965	missense	unknown
Z1176:Incenp	UTSW	19	9877687	missense	unknown
Z1177:Incenp	UTSW	19	9899364	start gained	probably benign

Predicted Primers

Posted On

2018-10-18