Mutagenetix > Incidental Mutation

Incidental Mutation 'R6885:Dock8'

536822

Institutional Source

Beutler Lab

Gene Symbol

Dock8

Ensembl Gene

ENSMUSG00000052085

Gene Name

dedicator of cytokinesis 8

Synonyms

A130095G14Rik, 5830472H07Rik, 1200017A24Rik

MMRRC Submission

045031-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R6885 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24999529-25202432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25147378 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1019 (D1019E)

Ref Sequence

ENSEMBL: ENSMUSP00000025831 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025831]

AlphaFold

Q8C147

PDB Structure

Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025831
AA Change: D1019E

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: D1019E

Domain	Start	End	E-Value	Type
Pfam:DUF3398	71	164	3.9e-25	PFAM
Pfam:DOCK-C2	557	739	6.7e-49	PFAM
low complexity region	786	803	N/A	INTRINSIC
low complexity region	1003	1020	N/A	INTRINSIC
low complexity region	1123	1138	N/A	INTRINSIC
low complexity region	1236	1246	N/A	INTRINSIC
low complexity region	1371	1383	N/A	INTRINSIC
Pfam:DHR-2	1534	2060	5e-210	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	G	7: 120,520,109	I1025M	probably benign	Het
Adamtsl5	T	A	10: 80,343,631	T164S	probably benign	Het
Ankar	C	T	1: 72,643,036	A1239T	unknown	Het
Aox4	A	T	1: 58,264,378	S1192C	probably damaging	Het
Atl2	T	C	17: 79,852,553	D68G	probably damaging	Het
Btnl4	T	C	17: 34,472,945	I228V	probably benign	Het
Catsper4	T	C	4: 134,215,149	T231A	probably benign	Het
Ccl12	A	T	11: 82,102,697	T54S	probably damaging	Het
Cntn1	T	C	15: 92,243,099		probably null	Het
Cog5	T	A	12: 31,894,199	D694E	probably damaging	Het
Crat	T	A	2: 30,415,196		probably benign	Het
Crot	T	C	5: 8,973,635	T418A	probably benign	Het
Cubn	G	A	2: 13,318,278	P2826L	probably damaging	Het
Dnah17	A	G	11: 118,090,772	F1698L	possibly damaging	Het
Eps15	A	G	4: 109,309,164	N85D	probably damaging	Het
Exoc1	T	C	5: 76,559,042	S457P	probably damaging	Het
Ext1	G	A	15: 53,101,692	T426I	probably damaging	Het
Fat1	T	C	8: 44,952,452	S747P	possibly damaging	Het
Gas7	A	G	11: 67,683,387	D396G	probably damaging	Het
Gm13023	T	C	4: 143,793,533	C116R	probably damaging	Het
Gm5114	G	T	7: 39,408,156	R680S	probably benign	Het
Gpcpd1	A	T	2: 132,554,074	L94M	possibly damaging	Het
Gse1	C	A	8: 120,229,482		probably benign	Het
Hmgb1	T	C	5: 149,050,661	E26G	probably benign	Het
Incenp	C	T	19: 9,875,132	R714Q	unknown	Het
Krt73	T	C	15: 101,796,398	E351G	probably damaging	Het
Ksr1	A	G	11: 79,047,295		probably null	Het
Lpin2	T	G	17: 71,215,150	S60A	probably damaging	Het
Lrrc71	T	C	3: 87,742,620		probably null	Het
Mafb	A	G	2: 160,366,019	S220P	possibly damaging	Het
Maml3	TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC	TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC	3: 51,697,579			Het
Mcmbp	T	C	7: 128,725,109		probably null	Het
Olfr1191-ps1	A	G	2: 88,643,597	T277A	probably damaging	Het
Olfr390	A	T	11: 73,787,100	H54L	possibly damaging	Het
Paqr9	T	C	9: 95,560,043	S29P	probably benign	Het
Parm1	A	G	5: 91,594,210	T146A	possibly damaging	Het
Pgm1	T	A	5: 64,103,878	F238L	probably benign	Het
Pigv	A	T	4: 133,665,481	F126Y	probably damaging	Het
Pitx2	T	C	3: 129,218,608	M222T	probably damaging	Het
Plekhg6	T	C	6: 125,378,730	N37S	probably benign	Het
Psme4	A	T	11: 30,834,307	K961*	probably null	Het
Rbpj	T	C	5: 53,653,151	W392R	probably damaging	Het
Reg3a	T	A	6: 78,381,055		probably null	Het
Rfc3	C	T	5: 151,648,284	S85N	probably benign	Het
Rtn3	T	C	19: 7,458,331	T80A	probably benign	Het
Sash1	T	C	10: 8,784,221	T195A	probably damaging	Het
Ska1	A	G	18: 74,206,839	V12A	probably benign	Het
Slc25a1	A	G	16: 17,927,430	V80A	probably benign	Het
Slc26a5	A	T	5: 21,834,344	V217D	probably damaging	Het
Slc46a1	A	G	11: 78,466,979	D286G	probably benign	Het
Spata2l	A	T	8: 123,235,558	L88Q	probably damaging	Het
Sptbn1	T	G	11: 30,138,634	Q876P	probably benign	Het
Tenm2	T	A	11: 36,023,580	I2377F	possibly damaging	Het
Thbs4	A	T	13: 92,762,869	D539E	probably damaging	Het
Tmem154	T	A	3: 84,692,506	C162S	possibly damaging	Het
Tpcn1	T	C	5: 120,544,437	E502G	probably benign	Het
Traf7	G	A	17: 24,512,292	R257C	probably benign	Het
Tsc22d2	T	C	3: 58,416,208	Y174H	probably damaging	Het
Usp8	A	G	2: 126,752,310	E802G	probably damaging	Het
Vmn1r5	T	C	6: 56,986,057	V239A	possibly damaging	Het
Vmn2r99	T	A	17: 19,380,195	S494T	possibly damaging	Het
Zbtb38	A	G	9: 96,686,464	F856L	probably damaging	Het

Other mutations in Dock8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
captain_morgan	APN	19	25127712	critical splice donor site	probably benign
primurus	APN	19	25183609	missense	probably damaging	1.00
IGL00737:Dock8	APN	19	25182976	missense	probably benign	0.00
IGL00755:Dock8	APN	19	25051509	missense	probably benign	0.09
IGL00822:Dock8	APN	19	25188409	nonsense	probably null
IGL00838:Dock8	APN	19	25175459	nonsense	probably null
IGL01419:Dock8	APN	19	25119452	missense	probably benign	0.08
IGL01456:Dock8	APN	19	25119499	missense	possibly damaging	0.95
IGL01532:Dock8	APN	19	25169441	missense	probably damaging	0.99
IGL01602:Dock8	APN	19	25089888	splice site	probably benign
IGL01605:Dock8	APN	19	25089888	splice site	probably benign
IGL01753:Dock8	APN	19	25061292	splice site	probably benign
IGL01843:Dock8	APN	19	25089928	missense	probably benign	0.02
IGL02032:Dock8	APN	19	25130405	missense	probably damaging	0.99
IGL02073:Dock8	APN	19	25200986	critical splice acceptor site	probably null
IGL02192:Dock8	APN	19	25078205	critical splice donor site	probably null
IGL02402:Dock8	APN	19	25078145	missense	probably benign	0.25
IGL02529:Dock8	APN	19	25100926	nonsense	probably null
IGL02728:Dock8	APN	19	25132220	missense	probably benign
IGL02739:Dock8	APN	19	25188488	missense	probably damaging	1.00
IGL03037:Dock8	APN	19	25086181	missense	probably benign	0.02
IGL03104:Dock8	APN	19	25201020	nonsense	probably null
IGL03137:Dock8	APN	19	25155948	missense	probably benign	0.19
IGL03365:Dock8	APN	19	25099684	missense	possibly damaging	0.70
Defenseless	UTSW	19	25051563	missense	probably benign	0.00
Guardate	UTSW	19	25149831	missense	probably benign
hillock	UTSW	19	25174333	critical splice donor site	probably null
Molehill	UTSW	19	25130461	missense	probably damaging	1.00
Pap	UTSW	19	25122441	missense	probably benign	0.31
Papilla	UTSW	19	25078084	nonsense	probably null
snowdrop	UTSW	19	25184941	critical splice donor site	probably null
warts_and_all	UTSW	19	25169501	critical splice donor site	probably null
R0021:Dock8	UTSW	19	25163047	missense	probably benign	0.01
R0147:Dock8	UTSW	19	25119459	missense	probably benign	0.00
R0148:Dock8	UTSW	19	25119459	missense	probably benign	0.00
R0294:Dock8	UTSW	19	25188350	missense	probably damaging	1.00
R0537:Dock8	UTSW	19	25171577	missense	probably benign	0.08
R0630:Dock8	UTSW	19	25061160	missense	probably benign	0.10
R1163:Dock8	UTSW	19	25051503	missense	probably benign
R1164:Dock8	UTSW	19	25090027	missense	probably benign	0.44
R1471:Dock8	UTSW	19	25201036	missense	possibly damaging	0.74
R1477:Dock8	UTSW	19	25095550	missense	possibly damaging	0.95
R1633:Dock8	UTSW	19	25051563	missense	probably benign	0.00
R1803:Dock8	UTSW	19	25132235	missense	probably benign	0.00
R1822:Dock8	UTSW	19	25161058	missense	probably benign	0.31
R1852:Dock8	UTSW	19	25127128	missense	probably benign	0.45
R1916:Dock8	UTSW	19	25061157	missense	probably benign	0.02
R1984:Dock8	UTSW	19	25121181	missense	probably null
R2311:Dock8	UTSW	19	25183004	missense	possibly damaging	0.93
R2341:Dock8	UTSW	19	25200393	missense	probably damaging	0.99
R2483:Dock8	UTSW	19	25079877	missense	probably benign
R3116:Dock8	UTSW	19	25188494	missense	probably benign	0.00
R3157:Dock8	UTSW	19	25149831	missense	probably benign
R3623:Dock8	UTSW	19	25079877	missense	probably benign
R3624:Dock8	UTSW	19	25079877	missense	probably benign
R3800:Dock8	UTSW	19	25164352	missense	probably benign	0.08
R3844:Dock8	UTSW	19	25065430	nonsense	probably null
R3895:Dock8	UTSW	19	25051501	missense	probably benign	0.31
R3901:Dock8	UTSW	19	25100905	missense	possibly damaging	0.69
R3959:Dock8	UTSW	19	25184941	critical splice donor site	probably null
R4428:Dock8	UTSW	19	25200499	missense	probably damaging	0.98
R4428:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4429:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4431:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4545:Dock8	UTSW	19	25188358	missense	probably damaging	1.00
R4839:Dock8	UTSW	19	25169494	missense	probably benign	0.00
R4897:Dock8	UTSW	19	25181637	missense	probably benign	0.00
R4939:Dock8	UTSW	19	25122400	missense	probably damaging	1.00
R4995:Dock8	UTSW	19	25158383	missense	probably benign	0.02
R5035:Dock8	UTSW	19	25086207	missense	probably damaging	0.99
R5294:Dock8	UTSW	19	25061153	missense	probably benign	0.01
R5324:Dock8	UTSW	19	25163094	missense	probably benign	0.17
R5478:Dock8	UTSW	19	25079822	missense	probably benign
R5704:Dock8	UTSW	19	25174222	missense	probably damaging	1.00
R5724:Dock8	UTSW	19	25122421	missense	probably damaging	1.00
R5745:Dock8	UTSW	19	25130397	missense	probably benign	0.02
R5864:Dock8	UTSW	19	25061220	missense	probably damaging	0.99
R5870:Dock8	UTSW	19	25132126	missense	probably benign
R5893:Dock8	UTSW	19	25122447	missense	probably damaging	1.00
R5954:Dock8	UTSW	19	25171619	missense	probably damaging	1.00
R6087:Dock8	UTSW	19	25161074	missense	probably benign	0.00
R6223:Dock8	UTSW	19	25161052	missense	probably benign	0.00
R6391:Dock8	UTSW	19	25095550	missense	possibly damaging	0.95
R6759:Dock8	UTSW	19	25127484	missense	probably damaging	0.99
R6786:Dock8	UTSW	19	25183022	missense	possibly damaging	0.49
R6794:Dock8	UTSW	19	25122441	missense	probably benign	0.31
R6818:Dock8	UTSW	19	25169501	critical splice donor site	probably null
R6908:Dock8	UTSW	19	25188382	missense	probably damaging	1.00
R6923:Dock8	UTSW	19	25095606	missense	probably benign
R7001:Dock8	UTSW	19	25099677	missense	probably benign
R7141:Dock8	UTSW	19	25181620	missense	probably null	0.75
R7203:Dock8	UTSW	19	25181563	missense	probably damaging	1.00
R7257:Dock8	UTSW	19	25127085	missense	probably benign	0.08
R7296:Dock8	UTSW	19	25184881	missense	probably benign	0.00
R7538:Dock8	UTSW	19	25158418	missense	probably damaging	1.00
R7555:Dock8	UTSW	19	25175400	missense	probably damaging	0.99
R7641:Dock8	UTSW	19	25174333	critical splice donor site	probably null
R7764:Dock8	UTSW	19	25097535	missense	probably benign
R7859:Dock8	UTSW	19	25183570	missense	probably damaging	1.00
R7864:Dock8	UTSW	19	25163500	missense	possibly damaging	0.95
R8090:Dock8	UTSW	19	25154242	missense	probably damaging	1.00
R8160:Dock8	UTSW	19	25147347	missense	probably damaging	1.00
R8287:Dock8	UTSW	19	25130461	missense	probably damaging	1.00
R8295:Dock8	UTSW	19	25123236	missense	probably benign	0.04
R8443:Dock8	UTSW	19	25155917	missense	probably benign	0.04
R8537:Dock8	UTSW	19	25130506	missense	probably benign	0.00
R8673:Dock8	UTSW	19	25183503	missense	probably damaging	0.96
R8709:Dock8	UTSW	19	25078084	nonsense	probably null
R8834:Dock8	UTSW	19	25163470	missense	probably benign	0.16
R8991:Dock8	UTSW	19	25188367	missense	possibly damaging	0.82
R9292:Dock8	UTSW	19	25183631	splice site	probably benign
R9509:Dock8	UTSW	19	25095621	missense	probably benign	0.00
R9526:Dock8	UTSW	19	25188375	missense	probably benign	0.10
R9622:Dock8	UTSW	19	25121181	missense	probably null
R9634:Dock8	UTSW	19	25192221	missense	probably damaging	1.00
R9654:Dock8	UTSW	19	25147346	missense	probably damaging	1.00
R9670:Dock8	UTSW	19	25171562	missense	probably null	0.01
R9699:Dock8	UTSW	19	25156024	critical splice donor site	probably null
R9726:Dock8	UTSW	19	25177010	missense	probably damaging	0.97
R9765:Dock8	UTSW	19	25169468	missense	possibly damaging	0.94
X0027:Dock8	UTSW	19	25161129	missense	probably benign
Z1177:Dock8	UTSW	19	25132123	missense	probably benign	0.05
Z1177:Dock8	UTSW	19	25155972	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- TCTTGGACACCATCAGCACC -3'
(R):5'- TAGGCCAGCATATTTTAACTGGTG -3'

Sequencing Primer
(F):5'- CAGGAAGTCCATCATGAAAGATTTCC -3'
(R):5'- GGTCAGTCAAGGCAAACA -3'

Posted On

2018-10-18