Incidental Mutation 'R6884:Ret'
ID 536838
Institutional Source Beutler Lab
Gene Symbol Ret
Ensembl Gene ENSMUSG00000030110
Gene Name ret proto-oncogene
Synonyms RET9, c-Ret, RET51
MMRRC Submission 044979-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.825) question?
Stock # R6884 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 118128706-118174679 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118132362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1026 (D1026G)
Ref Sequence ENSEMBL: ENSMUSP00000086169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032201] [ENSMUST00000088790]
AlphaFold P35546
Predicted Effect probably damaging
Transcript: ENSMUST00000032201
AA Change: D1026G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032201
Gene: ENSMUSG00000030110
AA Change: D1026G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088790
AA Change: D1026G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086169
Gene: ENSMUSG00000030110
AA Change: D1026G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some point mutations or knock-out alleles exhibit premature lethality, defects in neurogenesis, and abnormal kidney, ureter, ovary, muscle, and intestine morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,323,407 (GRCm39) probably benign Het
Abca5 C T 11: 110,220,043 (GRCm39) V8M probably damaging Het
Ahnak2 A T 12: 112,741,863 (GRCm39) D736E possibly damaging Het
Brpf3 A G 17: 29,050,324 (GRCm39) D1072G probably benign Het
Cacna1i C T 15: 80,259,010 (GRCm39) R1240C probably damaging Het
Ccdc40 A T 11: 119,133,565 (GRCm39) E568D possibly damaging Het
Col12a1 C T 9: 79,547,091 (GRCm39) G2247E possibly damaging Het
Dapk3 T A 10: 81,027,588 (GRCm39) probably null Het
Dcaf13 T C 15: 38,986,635 (GRCm39) W136R probably damaging Het
Dip2a C A 10: 76,108,366 (GRCm39) probably null Het
Eif3c T C 7: 126,156,051 (GRCm39) D473G probably benign Het
Erich2 G A 2: 70,339,505 (GRCm39) R20H possibly damaging Het
Gcnt7 T C 2: 172,296,125 (GRCm39) N233S probably damaging Het
Gdpd4 G T 7: 97,621,382 (GRCm39) L208F probably damaging Het
Gm10269 T A 18: 20,815,932 (GRCm39) Q30L possibly damaging Het
Gm7298 A T 6: 121,737,480 (GRCm39) I295F possibly damaging Het
Htr7 A G 19: 35,941,779 (GRCm39) probably null Het
Ing1 A G 8: 11,611,916 (GRCm39) Y118C probably damaging Het
Krtap16-1 C T 11: 99,877,284 (GRCm39) W40* probably null Het
Krtap26-1 A T 16: 88,444,467 (GRCm39) D51E probably damaging Het
Lama5 G A 2: 179,833,455 (GRCm39) P1519L probably damaging Het
Lrp1 T A 10: 127,394,986 (GRCm39) Q2513L probably benign Het
Morf4l1 A T 9: 89,976,532 (GRCm39) N265K probably damaging Het
Mpp2 T C 11: 101,952,904 (GRCm39) D299G probably benign Het
Mtcl1 C T 17: 66,745,197 (GRCm39) G55R probably damaging Het
Myb T A 10: 21,028,431 (GRCm39) K144I probably damaging Het
Myo18a T C 11: 77,709,875 (GRCm39) I587T possibly damaging Het
Nr2c2 A G 6: 92,135,374 (GRCm39) S288G probably benign Het
Obscn A G 11: 58,969,128 (GRCm39) Y2700H probably damaging Het
Or2z9 T C 8: 72,854,345 (GRCm39) V247A probably benign Het
Or6c3 T A 10: 129,309,023 (GRCm39) F154Y probably damaging Het
Pde6b A G 5: 108,536,574 (GRCm39) D90G probably damaging Het
Pigo A G 4: 43,022,627 (GRCm39) F315L possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,536,630 (GRCm39) probably benign Het
Rptn A T 3: 93,303,096 (GRCm39) Q143L probably benign Het
Rubcnl A G 14: 75,272,910 (GRCm39) E210G probably benign Het
Serpina1b T A 12: 103,698,712 (GRCm39) T46S probably benign Het
Serpinb9e A T 13: 33,435,609 (GRCm39) H14L probably benign Het
Shoc1 A G 4: 59,059,652 (GRCm39) S1003P possibly damaging Het
Slc25a25 A C 2: 32,310,674 (GRCm39) V168G probably benign Het
Slc35e1 T C 8: 73,238,726 (GRCm39) T261A possibly damaging Het
Spocd1 T C 4: 129,849,197 (GRCm39) probably benign Het
Tmem222 A T 4: 132,995,514 (GRCm39) Y178N probably damaging Het
Top1mt C T 15: 75,535,893 (GRCm39) E470K probably benign Het
Traj42 T C 14: 54,413,290 (GRCm39) probably benign Het
Tshr T C 12: 91,504,876 (GRCm39) Y13H probably damaging Het
Uvssa A G 5: 33,566,461 (GRCm39) probably null Het
Vmn1r28 G A 6: 58,242,633 (GRCm39) V159I probably benign Het
Vmn2r73 T A 7: 85,507,213 (GRCm39) T700S probably benign Het
Other mutations in Ret
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Ret APN 6 118,152,081 (GRCm39) splice site probably null
IGL02445:Ret APN 6 118,158,860 (GRCm39) missense probably damaging 0.98
IGL02754:Ret APN 6 118,153,213 (GRCm39) missense probably benign 0.03
IGL02828:Ret APN 6 118,153,168 (GRCm39) missense probably benign 0.00
IGL03058:Ret APN 6 118,152,028 (GRCm39) missense probably damaging 1.00
PIT4151001:Ret UTSW 6 118,141,702 (GRCm39) missense probably benign 0.04
R0126:Ret UTSW 6 118,142,956 (GRCm39) splice site probably benign
R0555:Ret UTSW 6 118,155,571 (GRCm39) missense probably damaging 0.96
R1168:Ret UTSW 6 118,150,519 (GRCm39) missense possibly damaging 0.94
R1829:Ret UTSW 6 118,130,912 (GRCm39) missense probably damaging 0.99
R2020:Ret UTSW 6 118,157,343 (GRCm39) missense possibly damaging 0.63
R4082:Ret UTSW 6 118,130,927 (GRCm39) missense possibly damaging 0.81
R4732:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R4733:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R5356:Ret UTSW 6 118,174,079 (GRCm39) missense possibly damaging 0.73
R5401:Ret UTSW 6 118,158,936 (GRCm39) missense probably benign 0.05
R5572:Ret UTSW 6 118,132,392 (GRCm39) missense probably damaging 1.00
R5669:Ret UTSW 6 118,161,204 (GRCm39) missense probably benign
R6058:Ret UTSW 6 118,156,280 (GRCm39) missense probably benign
R6087:Ret UTSW 6 118,153,252 (GRCm39) missense possibly damaging 0.53
R6412:Ret UTSW 6 118,161,245 (GRCm39) missense probably benign 0.00
R6457:Ret UTSW 6 118,150,582 (GRCm39) missense probably benign 0.01
R7035:Ret UTSW 6 118,140,247 (GRCm39) missense probably damaging 1.00
R7112:Ret UTSW 6 118,174,063 (GRCm39) missense possibly damaging 0.96
R7841:Ret UTSW 6 118,132,321 (GRCm39) missense probably damaging 1.00
R7947:Ret UTSW 6 118,151,305 (GRCm39) missense probably benign 0.32
R8539:Ret UTSW 6 118,152,770 (GRCm39) missense possibly damaging 0.60
R8556:Ret UTSW 6 118,146,149 (GRCm39) missense probably damaging 1.00
R8742:Ret UTSW 6 118,155,484 (GRCm39) missense probably damaging 0.99
R8904:Ret UTSW 6 118,157,174 (GRCm39) splice site probably benign
R9051:Ret UTSW 6 118,142,888 (GRCm39) nonsense probably null
R9323:Ret UTSW 6 118,158,975 (GRCm39) missense probably benign 0.00
R9661:Ret UTSW 6 118,150,437 (GRCm39) missense probably benign
R9674:Ret UTSW 6 118,130,830 (GRCm39) missense probably damaging 1.00
Z1176:Ret UTSW 6 118,140,168 (GRCm39) missense probably damaging 1.00
Z1177:Ret UTSW 6 118,130,851 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGTCGGTGGGATCAGAAACAC -3'
(R):5'- GGCTGTGGTCTTAACAGAGAG -3'

Sequencing Primer
(F):5'- GGATCAGAAACACTCTTTAAAAAGCG -3'
(R):5'- TGTGGTCTTAACAGAGAGGCCAAG -3'
Posted On 2018-10-18