Incidental Mutation 'R6884:Vmn2r73'
ID536840
Institutional Source Beutler Lab
Gene Symbol Vmn2r73
Ensembl Gene ENSMUSG00000070458
Gene Namevomeronasal 2, receptor 73
SynonymsEG620928
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R6884 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location85857547-85875938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85858005 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 700 (T700S)
Ref Sequence ENSEMBL: ENSMUSP00000076687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077478]
Predicted Effect probably benign
Transcript: ENSMUST00000077478
AA Change: T700S

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000076687
Gene: ENSMUSG00000070458
AA Change: T700S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.4e-30 PFAM
Pfam:NCD3G 508 560 5.9e-21 PFAM
Pfam:7tm_3 590 827 4.4e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,248 probably benign Het
Abca5 C T 11: 110,329,217 V8M probably damaging Het
Ahnak2 A T 12: 112,775,429 D736E possibly damaging Het
AI481877 A G 4: 59,059,652 S1003P possibly damaging Het
Brpf3 A G 17: 28,831,350 D1072G probably benign Het
Cacna1i C T 15: 80,374,809 R1240C probably damaging Het
Ccdc40 A T 11: 119,242,739 E568D possibly damaging Het
Col12a1 C T 9: 79,639,809 G2247E possibly damaging Het
Dapk3 T A 10: 81,191,754 probably null Het
Dcaf13 T C 15: 39,123,240 W136R probably damaging Het
Dip2a C A 10: 76,272,532 probably null Het
Eif3c T C 7: 126,556,879 D473G probably benign Het
Erich2 G A 2: 70,509,161 R20H possibly damaging Het
Gcnt7 T C 2: 172,454,205 N233S probably damaging Het
Gdpd4 G T 7: 97,972,175 L208F probably damaging Het
Gm10269 T A 18: 20,682,875 Q30L possibly damaging Het
Gm7298 A T 6: 121,760,521 I295F possibly damaging Het
Htr7 A G 19: 35,964,379 probably null Het
Ing1 A G 8: 11,561,916 Y118C probably damaging Het
Krtap16-1 C T 11: 99,986,458 W40* probably null Het
Krtap26-1 A T 16: 88,647,579 D51E probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1 T A 10: 127,559,117 Q2513L probably benign Het
Morf4l1 A T 9: 90,094,479 N265K probably damaging Het
Mpp2 T C 11: 102,062,078 D299G probably benign Het
Mtcl1 C T 17: 66,438,202 G55R probably damaging Het
Myb T A 10: 21,152,532 K144I probably damaging Het
Myo18a T C 11: 77,819,049 I587T possibly damaging Het
Nr2c2 A G 6: 92,158,393 S288G probably benign Het
Obscn A G 11: 59,078,302 Y2700H probably damaging Het
Olfr373 T C 8: 72,100,501 V247A probably benign Het
Olfr788 T A 10: 129,473,154 F154Y probably damaging Het
Pde6b A G 5: 108,388,708 D90G probably damaging Het
Pigo A G 4: 43,022,627 F315L possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ret T C 6: 118,155,401 D1026G probably damaging Het
Rptn A T 3: 93,395,789 Q143L probably benign Het
Rubcnl A G 14: 75,035,470 E210G probably benign Het
Serpina1b T A 12: 103,732,453 T46S probably benign Het
Serpinb9e A T 13: 33,251,626 H14L probably benign Het
Slc25a25 A C 2: 32,420,662 V168G probably benign Het
Slc35e1 T C 8: 72,484,882 T261A possibly damaging Het
Spocd1 T C 4: 129,955,404 probably benign Het
Tmem222 A T 4: 133,268,203 Y178N probably damaging Het
Top1mt C T 15: 75,664,044 E470K probably benign Het
Traj42 T C 14: 54,175,833 probably benign Het
Tshr T C 12: 91,538,102 Y13H probably damaging Het
Uvssa A G 5: 33,409,117 probably null Het
Vmn1r28 G A 6: 58,265,648 V159I probably benign Het
Other mutations in Vmn2r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r73 APN 7 85857587 missense probably benign
IGL01151:Vmn2r73 APN 7 85857878 missense probably damaging 0.99
IGL01408:Vmn2r73 APN 7 85872247 missense probably benign 0.45
IGL01505:Vmn2r73 APN 7 85858059 nonsense probably null
IGL01731:Vmn2r73 APN 7 85857549 makesense probably null
IGL01818:Vmn2r73 APN 7 85869901 splice site probably benign
IGL02236:Vmn2r73 APN 7 85872694 missense probably benign 0.00
IGL02265:Vmn2r73 APN 7 85871639 missense probably benign 0.02
IGL02266:Vmn2r73 APN 7 85875799 missense possibly damaging 0.52
IGL02276:Vmn2r73 APN 7 85869772 critical splice donor site probably null
IGL02284:Vmn2r73 APN 7 85857915 missense possibly damaging 0.92
IGL02380:Vmn2r73 APN 7 85858175 missense probably benign 0.00
IGL02466:Vmn2r73 APN 7 85872876 missense probably damaging 1.00
IGL03172:Vmn2r73 APN 7 85858287 missense probably benign 0.01
IGL03179:Vmn2r73 APN 7 85870260 missense probably benign 0.04
R0077:Vmn2r73 UTSW 7 85875867 missense probably benign 0.00
R0311:Vmn2r73 UTSW 7 85871789 missense probably benign
R0413:Vmn2r73 UTSW 7 85871879 missense possibly damaging 0.68
R0494:Vmn2r73 UTSW 7 85872932 missense probably benign
R1523:Vmn2r73 UTSW 7 85870278 missense probably benign 0.02
R1618:Vmn2r73 UTSW 7 85875912 nonsense probably null
R1667:Vmn2r73 UTSW 7 85857681 missense probably benign 0.00
R1728:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1729:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1747:Vmn2r73 UTSW 7 85858167 missense probably damaging 1.00
R1784:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R2152:Vmn2r73 UTSW 7 85857728 missense probably benign 0.03
R2395:Vmn2r73 UTSW 7 85857767 missense probably damaging 1.00
R2415:Vmn2r73 UTSW 7 85872223 missense probably damaging 1.00
R2926:Vmn2r73 UTSW 7 85871663 missense probably benign 0.17
R3719:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R3766:Vmn2r73 UTSW 7 85871990 missense probably benign
R3838:Vmn2r73 UTSW 7 85858050 missense probably benign 0.00
R3890:Vmn2r73 UTSW 7 85857936 missense probably benign
R4030:Vmn2r73 UTSW 7 85871836 missense possibly damaging 0.92
R4247:Vmn2r73 UTSW 7 85872675 missense probably damaging 0.99
R4409:Vmn2r73 UTSW 7 85871560 missense probably damaging 0.97
R4427:Vmn2r73 UTSW 7 85857773 missense probably damaging 1.00
R4430:Vmn2r73 UTSW 7 85870241 missense probably benign
R4552:Vmn2r73 UTSW 7 85875847 missense probably benign 0.12
R4779:Vmn2r73 UTSW 7 85871715 nonsense probably null
R4906:Vmn2r73 UTSW 7 85857621 missense probably damaging 0.99
R4942:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R5280:Vmn2r73 UTSW 7 85857947 missense probably damaging 0.98
R5344:Vmn2r73 UTSW 7 85875838 missense probably benign 0.00
R5478:Vmn2r73 UTSW 7 85869788 missense probably damaging 1.00
R5527:Vmn2r73 UTSW 7 85858367 missense possibly damaging 0.65
R5691:Vmn2r73 UTSW 7 85858091 missense probably damaging 1.00
R5826:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
R6018:Vmn2r73 UTSW 7 85872667 missense possibly damaging 0.48
R6082:Vmn2r73 UTSW 7 85858221 missense probably benign 0.00
R6111:Vmn2r73 UTSW 7 85871789 missense probably benign
R6233:Vmn2r73 UTSW 7 85869891 missense probably benign 0.00
R6278:Vmn2r73 UTSW 7 85872932 missense probably benign
R6283:Vmn2r73 UTSW 7 85871841 missense probably benign 0.00
R6307:Vmn2r73 UTSW 7 85857620 missense probably damaging 1.00
R6413:Vmn2r73 UTSW 7 85870336 nonsense probably null
R6782:Vmn2r73 UTSW 7 85870355 missense probably benign 0.00
R6921:Vmn2r73 UTSW 7 85858238 missense probably benign 0.27
R7169:Vmn2r73 UTSW 7 85858455 nonsense probably null
R7206:Vmn2r73 UTSW 7 85872867 missense probably benign 0.03
R7311:Vmn2r73 UTSW 7 85871984 missense possibly damaging 0.80
R7650:Vmn2r73 UTSW 7 85871939 missense probably benign
R7811:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
X0023:Vmn2r73 UTSW 7 85858456 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGAATGTCAAGAGCTTGGCTTC -3'
(R):5'- TCATCTGTGTCCTGCAGCAG -3'

Sequencing Primer
(F):5'- CAAGAGCTTGGCTTCATTGAATG -3'
(R):5'- TCCTGCAGCAGAGCACATTTG -3'
Posted On2018-10-18