Incidental Mutation 'R6884:Serpinb9e'
ID536862
Institutional Source Beutler Lab
Gene Symbol Serpinb9e
Ensembl Gene ENSMUSG00000062342
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9e
SynonymsSpi14, ovalbumin, NK26
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6884 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location33249612-33260850 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33251626 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 14 (H14L)
Ref Sequence ENSEMBL: ENSMUSP00000071769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071873]
Predicted Effect probably benign
Transcript: ENSMUST00000071873
AA Change: H14L

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000071769
Gene: ENSMUSG00000062342
AA Change: H14L

DomainStartEndE-ValueType
SERPIN 13 377 1.82e-168 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,248 probably benign Het
Abca5 C T 11: 110,329,217 V8M probably damaging Het
Ahnak2 A T 12: 112,775,429 D736E possibly damaging Het
AI481877 A G 4: 59,059,652 S1003P possibly damaging Het
Brpf3 A G 17: 28,831,350 D1072G probably benign Het
Cacna1i C T 15: 80,374,809 R1240C probably damaging Het
Ccdc40 A T 11: 119,242,739 E568D possibly damaging Het
Col12a1 C T 9: 79,639,809 G2247E possibly damaging Het
Dapk3 T A 10: 81,191,754 probably null Het
Dcaf13 T C 15: 39,123,240 W136R probably damaging Het
Dip2a C A 10: 76,272,532 probably null Het
Eif3c T C 7: 126,556,879 D473G probably benign Het
Erich2 G A 2: 70,509,161 R20H possibly damaging Het
Gcnt7 T C 2: 172,454,205 N233S probably damaging Het
Gdpd4 G T 7: 97,972,175 L208F probably damaging Het
Gm10269 T A 18: 20,682,875 Q30L possibly damaging Het
Gm7298 A T 6: 121,760,521 I295F possibly damaging Het
Htr7 A G 19: 35,964,379 probably null Het
Ing1 A G 8: 11,561,916 Y118C probably damaging Het
Krtap16-1 C T 11: 99,986,458 W40* probably null Het
Krtap26-1 A T 16: 88,647,579 D51E probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1 T A 10: 127,559,117 Q2513L probably benign Het
Morf4l1 A T 9: 90,094,479 N265K probably damaging Het
Mpp2 T C 11: 102,062,078 D299G probably benign Het
Mtcl1 C T 17: 66,438,202 G55R probably damaging Het
Myb T A 10: 21,152,532 K144I probably damaging Het
Myo18a T C 11: 77,819,049 I587T possibly damaging Het
Nr2c2 A G 6: 92,158,393 S288G probably benign Het
Obscn A G 11: 59,078,302 Y2700H probably damaging Het
Olfr373 T C 8: 72,100,501 V247A probably benign Het
Olfr788 T A 10: 129,473,154 F154Y probably damaging Het
Pde6b A G 5: 108,388,708 D90G probably damaging Het
Pigo A G 4: 43,022,627 F315L possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ret T C 6: 118,155,401 D1026G probably damaging Het
Rptn A T 3: 93,395,789 Q143L probably benign Het
Rubcnl A G 14: 75,035,470 E210G probably benign Het
Serpina1b T A 12: 103,732,453 T46S probably benign Het
Slc25a25 A C 2: 32,420,662 V168G probably benign Het
Slc35e1 T C 8: 72,484,882 T261A possibly damaging Het
Spocd1 T C 4: 129,955,404 probably benign Het
Tmem222 A T 4: 133,268,203 Y178N probably damaging Het
Top1mt C T 15: 75,664,044 E470K probably benign Het
Traj42 T C 14: 54,175,833 probably benign Het
Tshr T C 12: 91,538,102 Y13H probably damaging Het
Uvssa A G 5: 33,409,117 probably null Het
Vmn1r28 G A 6: 58,265,648 V159I probably benign Het
Vmn2r73 T A 7: 85,858,005 T700S probably benign Het
Other mutations in Serpinb9e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Serpinb9e APN 13 33255125 missense probably damaging 0.97
IGL02352:Serpinb9e APN 13 33257820 splice site probably benign
IGL02359:Serpinb9e APN 13 33257820 splice site probably benign
IGL02604:Serpinb9e APN 13 33257759 missense probably benign 0.00
IGL02859:Serpinb9e APN 13 33251650 missense possibly damaging 0.83
R0257:Serpinb9e UTSW 13 33257681 missense probably benign 0.24
R0751:Serpinb9e UTSW 13 33259774 missense probably benign 0.00
R1101:Serpinb9e UTSW 13 33260088 missense probably benign 0.10
R1170:Serpinb9e UTSW 13 33257752 nonsense probably null
R1184:Serpinb9e UTSW 13 33259774 missense probably benign 0.00
R1253:Serpinb9e UTSW 13 33255119 missense possibly damaging 0.77
R1405:Serpinb9e UTSW 13 33260026 missense probably benign
R1405:Serpinb9e UTSW 13 33260026 missense probably benign
R1463:Serpinb9e UTSW 13 33255116 missense probably benign
R1566:Serpinb9e UTSW 13 33253494 missense probably damaging 1.00
R1924:Serpinb9e UTSW 13 33253445 missense probably benign 0.07
R1964:Serpinb9e UTSW 13 33253491 missense probably benign 0.04
R2153:Serpinb9e UTSW 13 33252978 missense probably damaging 1.00
R2405:Serpinb9e UTSW 13 33260080 missense probably benign
R2972:Serpinb9e UTSW 13 33255143 missense probably benign
R2973:Serpinb9e UTSW 13 33255143 missense probably benign
R2974:Serpinb9e UTSW 13 33255143 missense probably benign
R3854:Serpinb9e UTSW 13 33255154 missense probably benign 0.40
R4173:Serpinb9e UTSW 13 33255158 missense probably damaging 0.97
R4937:Serpinb9e UTSW 13 33252952 missense probably benign 0.11
R4949:Serpinb9e UTSW 13 33251608 missense possibly damaging 0.81
R5347:Serpinb9e UTSW 13 33257784 missense probably damaging 1.00
R5976:Serpinb9e UTSW 13 33255129 missense probably benign
R5979:Serpinb9e UTSW 13 33255053 missense probably benign 0.18
R5991:Serpinb9e UTSW 13 33259807 missense probably damaging 1.00
R6059:Serpinb9e UTSW 13 33257774 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GTGTTCCTGCTATGATCAACTTAC -3'
(R):5'- AGCAGCTCTTGTGCATGTGG -3'

Sequencing Primer
(F):5'- CCAGAAGTAGAGTTCCGT -3'
(R):5'- GGCAAGGGTATGGTTTCACAG -3'
Posted On2018-10-18