Incidental Mutation 'R6884:Htr7'
ID536872
Institutional Source Beutler Lab
Gene Symbol Htr7
Ensembl Gene ENSMUSG00000024798
Gene Name5-hydroxytryptamine (serotonin) receptor 7
Synonyms5-HT7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6884 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location35958734-36057507 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 35964379 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099505] [ENSMUST00000099505] [ENSMUST00000099505] [ENSMUST00000164639] [ENSMUST00000164781] [ENSMUST00000165215] [ENSMUST00000166074] [ENSMUST00000170360]
Predicted Effect probably null
Transcript: ENSMUST00000099505
SMART Domains Protein: ENSMUSP00000097105
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 2.3e-9 PFAM
Pfam:7tm_1 101 387 4.8e-75 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099505
SMART Domains Protein: ENSMUSP00000097105
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 2.3e-9 PFAM
Pfam:7tm_1 101 387 4.8e-75 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099505
SMART Domains Protein: ENSMUSP00000097105
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 2.3e-9 PFAM
Pfam:7tm_1 101 387 4.8e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164639
SMART Domains Protein: ENSMUSP00000126847
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 1.3e-9 PFAM
Pfam:7tm_1 101 387 1.7e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164781
SMART Domains Protein: ENSMUSP00000131912
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
Pfam:7tm_1 101 185 2.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165215
SMART Domains Protein: ENSMUSP00000128386
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
Pfam:7tm_1 101 183 7.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166074
SMART Domains Protein: ENSMUSP00000126150
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 2.7e-9 PFAM
Pfam:7tm_1 101 387 5.6e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170360
SMART Domains Protein: ENSMUSP00000131517
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 247 9.6e-9 PFAM
Pfam:7tm_1 101 252 1.4e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neurotransmitter, serotonin, is thought to play a role in various cognitive and behavioral functions. The serotonin receptor encoded by this gene belongs to the superfamily of G protein-coupled receptors and the gene is a candidate locus for involvement in autistic disorder and other neuropsychiatric disorders. Three splice variants have been identified which encode proteins that differ in the length of their carboxy terminal ends. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display lower electrically- and chemically-induced seizure thresholds. Mice homozygous for a different knock-out allele show enhanced coordination and higher thermal nociceptive thresholds. Other nullizygous mutantsfail to exhibit agonist-induced hypothermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,248 probably benign Het
Abca5 C T 11: 110,329,217 V8M probably damaging Het
Ahnak2 A T 12: 112,775,429 D736E possibly damaging Het
AI481877 A G 4: 59,059,652 S1003P possibly damaging Het
Brpf3 A G 17: 28,831,350 D1072G probably benign Het
Cacna1i C T 15: 80,374,809 R1240C probably damaging Het
Ccdc40 A T 11: 119,242,739 E568D possibly damaging Het
Col12a1 C T 9: 79,639,809 G2247E possibly damaging Het
Dapk3 T A 10: 81,191,754 probably null Het
Dcaf13 T C 15: 39,123,240 W136R probably damaging Het
Dip2a C A 10: 76,272,532 probably null Het
Eif3c T C 7: 126,556,879 D473G probably benign Het
Erich2 G A 2: 70,509,161 R20H possibly damaging Het
Gcnt7 T C 2: 172,454,205 N233S probably damaging Het
Gdpd4 G T 7: 97,972,175 L208F probably damaging Het
Gm10269 T A 18: 20,682,875 Q30L possibly damaging Het
Gm7298 A T 6: 121,760,521 I295F possibly damaging Het
Ing1 A G 8: 11,561,916 Y118C probably damaging Het
Krtap16-1 C T 11: 99,986,458 W40* probably null Het
Krtap26-1 A T 16: 88,647,579 D51E probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1 T A 10: 127,559,117 Q2513L probably benign Het
Morf4l1 A T 9: 90,094,479 N265K probably damaging Het
Mpp2 T C 11: 102,062,078 D299G probably benign Het
Mtcl1 C T 17: 66,438,202 G55R probably damaging Het
Myb T A 10: 21,152,532 K144I probably damaging Het
Myo18a T C 11: 77,819,049 I587T possibly damaging Het
Nr2c2 A G 6: 92,158,393 S288G probably benign Het
Obscn A G 11: 59,078,302 Y2700H probably damaging Het
Olfr373 T C 8: 72,100,501 V247A probably benign Het
Olfr788 T A 10: 129,473,154 F154Y probably damaging Het
Pde6b A G 5: 108,388,708 D90G probably damaging Het
Pigo A G 4: 43,022,627 F315L possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ret T C 6: 118,155,401 D1026G probably damaging Het
Rptn A T 3: 93,395,789 Q143L probably benign Het
Rubcnl A G 14: 75,035,470 E210G probably benign Het
Serpina1b T A 12: 103,732,453 T46S probably benign Het
Serpinb9e A T 13: 33,251,626 H14L probably benign Het
Slc25a25 A C 2: 32,420,662 V168G probably benign Het
Slc35e1 T C 8: 72,484,882 T261A possibly damaging Het
Spocd1 T C 4: 129,955,404 probably benign Het
Tmem222 A T 4: 133,268,203 Y178N probably damaging Het
Top1mt C T 15: 75,664,044 E470K probably benign Het
Traj42 T C 14: 54,175,833 probably benign Het
Tshr T C 12: 91,538,102 Y13H probably damaging Het
Uvssa A G 5: 33,409,117 probably null Het
Vmn1r28 G A 6: 58,265,648 V159I probably benign Het
Vmn2r73 T A 7: 85,858,005 T700S probably benign Het
Other mutations in Htr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02683:Htr7 APN 19 35960362 missense probably benign 0.00
R0009:Htr7 UTSW 19 36041540 intron probably benign
R0318:Htr7 UTSW 19 35969486 missense probably damaging 1.00
R1695:Htr7 UTSW 19 35969736 missense probably benign 0.01
R2316:Htr7 UTSW 19 35969303 critical splice donor site probably null
R3973:Htr7 UTSW 19 36056760 missense probably damaging 1.00
R5041:Htr7 UTSW 19 36057067 missense probably benign 0.10
R5203:Htr7 UTSW 19 35964392 missense probably benign 0.00
R5236:Htr7 UTSW 19 36056769 missense probably damaging 1.00
R5538:Htr7 UTSW 19 35969835 missense probably benign 0.34
R5682:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5683:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5684:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5686:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5694:Htr7 UTSW 19 36057121 missense probably benign 0.00
R6273:Htr7 UTSW 19 36041569 intron probably benign
R6502:Htr7 UTSW 19 35969610 missense probably damaging 1.00
R6558:Htr7 UTSW 19 36057240 missense probably damaging 1.00
R7074:Htr7 UTSW 19 36056883 missense probably damaging 0.99
R7592:Htr7 UTSW 19 36056892 missense probably damaging 1.00
X0064:Htr7 UTSW 19 36056755 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGCTTCAAAACAATCCCATGG -3'
(R):5'- CTTTTCTGTGTGAGCAATCTAGAC -3'

Sequencing Primer
(F):5'- GAACAAGTTCTCATGGCATGATAG -3'
(R):5'- TCTGTGTGAGCAATCTAGACTATATG -3'
Posted On2018-10-18