Incidental Mutation 'R6883:Inpp5d'
ID536875
Institutional Source Beutler Lab
Gene Symbol Inpp5d
Ensembl Gene ENSMUSG00000026288
Gene Nameinositol polyphosphate-5-phosphatase D
Synonymss-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R6883 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location87620312-87720507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 87699690 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 308 (K308T)
Ref Sequence ENSEMBL: ENSMUSP00000132384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000167032] [ENSMUST00000168783] [ENSMUST00000169754] [ENSMUST00000170300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042275
AA Change: K570T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: K570T

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 954 979 N/A INTRINSIC
low complexity region 1045 1057 N/A INTRINSIC
low complexity region 1119 1131 N/A INTRINSIC
low complexity region 1139 1148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072999
AA Change: K570T

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288
AA Change: K570T

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 932 953 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167032
AA Change: K308T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288
AA Change: K308T

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 692 717 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168783
AA Change: K571T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288
AA Change: K571T

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 4.5e-104 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
low complexity region 1079 1088 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169754
AA Change: K571T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: K571T

DomainStartEndE-ValueType
SH2 6 95 4.6e-31 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 2.2e-106 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 955 980 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
low complexity region 1140 1149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170300
AA Change: K308T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288
AA Change: K308T

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 796 808 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 92% (45/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,152,835 H1261L possibly damaging Het
Acaa1b A G 9: 119,156,660 S66P possibly damaging Het
Adh7 A T 3: 138,224,064 E167V probably damaging Het
Ano6 T C 15: 95,962,111 S705P probably damaging Het
Arpc1b T C 5: 145,126,929 V329A probably benign Het
Btla C T 16: 45,242,729 H152Y probably benign Het
Cadps T C 14: 12,465,883 E1009G probably damaging Het
Cttnbp2nl A G 3: 105,011,191 probably null Het
Cyp4a12a G T 4: 115,302,024 V164F probably damaging Het
Duox1 G T 2: 122,324,584 probably null Het
Fmo6 A G 1: 162,929,892 I104T probably damaging Het
Fnbp4 T C 2: 90,745,828 probably null Het
Garem1 T C 18: 21,129,712 T682A probably benign Het
Gm49358 A G 10: 86,815,898 E188G probably benign Het
Gm5773 T C 3: 93,773,855 I278T probably benign Het
Ifi27l2a A G 12: 103,443,497 probably benign Het
Irf6 A T 1: 193,167,466 Y232F probably damaging Het
Kcnmb4 T C 10: 116,473,343 Q60R probably benign Het
Klri2 T C 6: 129,733,022 D205G probably benign Het
Mcm9 A T 10: 53,616,014 W352R probably damaging Het
Nat8 A G 6: 85,830,668 V161A possibly damaging Het
Nlrp9c A T 7: 26,378,131 M742K probably benign Het
Olfr1124 C A 2: 87,435,279 T264K probably damaging Het
Olfr1436 C A 19: 12,298,570 Q187H probably damaging Het
Olfr71 T C 4: 43,705,723 T282A possibly damaging Het
Pcdha11 A T 18: 37,011,189 D111V probably damaging Het
Pcdhb6 A T 18: 37,335,145 D373V probably damaging Het
Pcolce2 A T 9: 95,678,343 probably null Het
Pik3cb T C 9: 99,101,400 M52V probably benign Het
Pipox T C 11: 77,883,903 E118G probably benign Het
Pou4f2 T C 8: 78,435,678 S99G probably benign Het
Ptpn12 T A 5: 21,055,713 Q12L probably benign Het
Sim2 G T 16: 94,125,536 A540S probably benign Het
Smg1 A T 7: 118,168,180 probably benign Het
Sntb1 A G 15: 55,906,323 V90A probably benign Het
Spns2 T C 11: 72,456,370 probably null Het
Syne1 G T 10: 5,231,704 C4210* probably null Het
Tek T C 4: 94,837,189 I564T possibly damaging Het
Tmem94 T G 11: 115,796,461 C1135W probably damaging Het
Tnxb T A 17: 34,718,519 D3827E probably damaging Het
Ttl A G 2: 129,082,072 D235G possibly damaging Het
Tuba4a A G 1: 75,217,422 S5P probably damaging Het
Uaca T A 9: 60,869,891 V518D probably damaging Het
Unc80 A T 1: 66,646,404 Q2229L probably benign Het
Unkl C T 17: 25,230,333 A78V probably damaging Het
Uroc1 C T 6: 90,338,592 Q152* probably null Het
Vmn2r51 G T 7: 10,100,098 Q338K possibly damaging Het
Vps50 C T 6: 3,498,513 probably benign Het
Other mutations in Inpp5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Inpp5d APN 1 87683815 missense probably benign 0.00
IGL00329:Inpp5d APN 1 87668003 missense probably benign 0.00
IGL00897:Inpp5d APN 1 87712114 missense probably benign 0.14
IGL01314:Inpp5d APN 1 87683750 nonsense probably null
IGL02145:Inpp5d APN 1 87715055 missense probably damaging 1.00
IGL02422:Inpp5d APN 1 87708132 missense probably damaging 1.00
IGL02538:Inpp5d APN 1 87695366 missense probably null 0.92
IGL02680:Inpp5d APN 1 87701483 missense possibly damaging 0.87
IGL03083:Inpp5d APN 1 87711141 missense probably damaging 1.00
IGL03308:Inpp5d APN 1 87703197 missense probably damaging 1.00
americas UTSW 1 87715142 missense probably damaging 1.00
auburn UTSW 1 87681680 splice site probably null
naranjo UTSW 1 87708211 critical splice donor site probably null
New_black UTSW 1 87709675 missense probably damaging 1.00
Orange UTSW 1 87697546 critical splice donor site probably null
pantone UTSW 1 87699675 missense probably damaging 1.00
sailing UTSW 1 87705964 missense probably damaging 1.00
styx UTSW 1 87669784 critical splice donor site probably benign
ulster UTSW 1 87701476 nonsense probably null
R0010:Inpp5d UTSW 1 87697546 critical splice donor site probably null
R0037:Inpp5d UTSW 1 87708129 missense probably damaging 0.99
R0087:Inpp5d UTSW 1 87715138 missense probably damaging 1.00
R0492:Inpp5d UTSW 1 87698150 missense possibly damaging 0.94
R0520:Inpp5d UTSW 1 87705920 splice site probably benign
R0733:Inpp5d UTSW 1 87668077 splice site probably benign
R1464:Inpp5d UTSW 1 87698105 splice site probably benign
R1576:Inpp5d UTSW 1 87669685 missense probably benign 0.16
R1576:Inpp5d UTSW 1 87681558 missense probably damaging 0.96
R1592:Inpp5d UTSW 1 87665532 missense possibly damaging 0.90
R1750:Inpp5d UTSW 1 87699081 missense probably damaging 1.00
R1774:Inpp5d UTSW 1 87667889 missense probably benign 0.30
R1972:Inpp5d UTSW 1 87676314 missense probably benign 0.00
R2024:Inpp5d UTSW 1 87695350 nonsense probably null
R2405:Inpp5d UTSW 1 87699729 missense possibly damaging 0.94
R3412:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3414:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3756:Inpp5d UTSW 1 87701408 splice site probably benign
R4652:Inpp5d UTSW 1 87665451 missense probably benign 0.03
R4676:Inpp5d UTSW 1 87715142 missense probably damaging 1.00
R4834:Inpp5d UTSW 1 87697523 missense possibly damaging 0.52
R5086:Inpp5d UTSW 1 87705964 missense probably damaging 1.00
R5159:Inpp5d UTSW 1 87676342 missense probably damaging 1.00
R5250:Inpp5d UTSW 1 87709675 missense probably damaging 1.00
R5442:Inpp5d UTSW 1 87718066 missense probably benign 0.02
R5875:Inpp5d UTSW 1 87717974 missense possibly damaging 0.47
R6135:Inpp5d UTSW 1 87620397 unclassified probably null
R6371:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6385:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6386:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6526:Inpp5d UTSW 1 87676250 start gained probably benign
R6572:Inpp5d UTSW 1 87695396 missense probably damaging 0.99
R6831:Inpp5d UTSW 1 87701476 nonsense probably null
R6853:Inpp5d UTSW 1 87681680 splice site probably null
R7082:Inpp5d UTSW 1 87695380 missense probably damaging 0.99
R7215:Inpp5d UTSW 1 87701218 missense probably benign 0.30
R7418:Inpp5d UTSW 1 87708211 critical splice donor site probably null
R7471:Inpp5d UTSW 1 87695400 missense probably damaging 1.00
R7593:Inpp5d UTSW 1 87717778 missense possibly damaging 0.82
R7716:Inpp5d UTSW 1 87665399 missense probably damaging 0.97
R7781:Inpp5d UTSW 1 87699672 missense probably damaging 1.00
R7808:Inpp5d UTSW 1 87683845 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGACAGAGCTTGAGTCTAAG -3'
(R):5'- TGACAGGAGCTGTATTGAGATCC -3'

Sequencing Primer
(F):5'- ACAGAGCTTGAGTCTAAGTCTCTG -3'
(R):5'- GCGAAGAGCTGCTACCTTAG -3'
Posted On2018-10-18