Incidental Mutation 'R6883:Nlrp9c'
ID536895
Institutional Source Beutler Lab
Gene Symbol Nlrp9c
Ensembl Gene ENSMUSG00000040614
Gene NameNLR family, pyrin domain containing 9C
SynonymsNalp9c, Nalp-zeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6883 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location26322473-26403700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26378131 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 742 (M742K)
Ref Sequence ENSEMBL: ENSMUSP00000083106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041845] [ENSMUST00000085944]
Predicted Effect probably benign
Transcript: ENSMUST00000041845
AA Change: M687K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000036041
Gene: ENSMUSG00000040614
AA Change: M687K

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 5.2e-31 PFAM
LRR 637 664 4.36e1 SMART
Blast:LRR 666 691 3e-6 BLAST
LRR 693 720 1.02e0 SMART
LRR 722 749 3e0 SMART
LRR 750 777 6.88e-4 SMART
LRR 779 806 5.06e0 SMART
LRR 807 834 1.22e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085944
AA Change: M742K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000083106
Gene: ENSMUSG00000040614
AA Change: M742K

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 2.8e-31 PFAM
LRR 631 658 7.49e0 SMART
LRR 692 719 4.36e1 SMART
Blast:LRR 721 746 8e-6 BLAST
LRR 748 775 1.02e0 SMART
LRR 777 804 3e0 SMART
LRR 805 832 6.88e-4 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.12e-4 SMART
LRR 919 946 1.22e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 92% (45/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,152,835 H1261L possibly damaging Het
Acaa1b A G 9: 119,156,660 S66P possibly damaging Het
Adh7 A T 3: 138,224,064 E167V probably damaging Het
Ano6 T C 15: 95,962,111 S705P probably damaging Het
Arpc1b T C 5: 145,126,929 V329A probably benign Het
Btla C T 16: 45,242,729 H152Y probably benign Het
Cadps T C 14: 12,465,883 E1009G probably damaging Het
Cttnbp2nl A G 3: 105,011,191 probably null Het
Cyp4a12a G T 4: 115,302,024 V164F probably damaging Het
Duox1 G T 2: 122,324,584 probably null Het
Fmo6 A G 1: 162,929,892 I104T probably damaging Het
Fnbp4 T C 2: 90,745,828 probably null Het
Garem1 T C 18: 21,129,712 T682A probably benign Het
Gm49358 A G 10: 86,815,898 E188G probably benign Het
Gm5773 T C 3: 93,773,855 I278T probably benign Het
Ifi27l2a A G 12: 103,443,497 probably benign Het
Inpp5d A C 1: 87,699,690 K308T probably damaging Het
Irf6 A T 1: 193,167,466 Y232F probably damaging Het
Kcnmb4 T C 10: 116,473,343 Q60R probably benign Het
Klri2 T C 6: 129,733,022 D205G probably benign Het
Mcm9 A T 10: 53,616,014 W352R probably damaging Het
Nat8 A G 6: 85,830,668 V161A possibly damaging Het
Olfr1124 C A 2: 87,435,279 T264K probably damaging Het
Olfr1436 C A 19: 12,298,570 Q187H probably damaging Het
Olfr71 T C 4: 43,705,723 T282A possibly damaging Het
Pcdha11 A T 18: 37,011,189 D111V probably damaging Het
Pcdhb6 A T 18: 37,335,145 D373V probably damaging Het
Pcolce2 A T 9: 95,678,343 probably null Het
Pik3cb T C 9: 99,101,400 M52V probably benign Het
Pipox T C 11: 77,883,903 E118G probably benign Het
Pou4f2 T C 8: 78,435,678 S99G probably benign Het
Ptpn12 T A 5: 21,055,713 Q12L probably benign Het
Sim2 G T 16: 94,125,536 A540S probably benign Het
Smg1 A T 7: 118,168,180 probably benign Het
Sntb1 A G 15: 55,906,323 V90A probably benign Het
Spns2 T C 11: 72,456,370 probably null Het
Syne1 G T 10: 5,231,704 C4210* probably null Het
Tek T C 4: 94,837,189 I564T possibly damaging Het
Tmem94 T G 11: 115,796,461 C1135W probably damaging Het
Tnxb T A 17: 34,718,519 D3827E probably damaging Het
Ttl A G 2: 129,082,072 D235G possibly damaging Het
Tuba4a A G 1: 75,217,422 S5P probably damaging Het
Uaca T A 9: 60,869,891 V518D probably damaging Het
Unc80 A T 1: 66,646,404 Q2229L probably benign Het
Unkl C T 17: 25,230,333 A78V probably damaging Het
Uroc1 C T 6: 90,338,592 Q152* probably null Het
Vmn2r51 G T 7: 10,100,098 Q338K possibly damaging Het
Vps50 C T 6: 3,498,513 probably benign Het
Other mutations in Nlrp9c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Nlrp9c APN 7 26384588 missense probably benign 0.00
IGL00814:Nlrp9c APN 7 26384750 missense probably benign 0.23
IGL00919:Nlrp9c APN 7 26394056 nonsense probably null
IGL01762:Nlrp9c APN 7 26385425 missense probably damaging 1.00
IGL01928:Nlrp9c APN 7 26375422 splice site probably benign
IGL02008:Nlrp9c APN 7 26385151 missense probably benign 0.16
IGL02389:Nlrp9c APN 7 26394207 missense probably benign
IGL02535:Nlrp9c APN 7 26372097 missense probably damaging 1.00
IGL02685:Nlrp9c APN 7 26385557 missense probably damaging 0.98
IGL02904:Nlrp9c APN 7 26375290 missense probably damaging 1.00
IGL02935:Nlrp9c APN 7 26385276 missense probably benign 0.00
IGL03006:Nlrp9c APN 7 26372082 missense probably damaging 0.98
IGL03140:Nlrp9c APN 7 26380489 missense probably benign 0.30
IGL03201:Nlrp9c APN 7 26385108 missense probably benign 0.00
IGL03243:Nlrp9c APN 7 26365032 missense probably damaging 0.99
IGL03054:Nlrp9c UTSW 7 26382276 splice site probably null
K7894:Nlrp9c UTSW 7 26384898 missense possibly damaging 0.94
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0335:Nlrp9c UTSW 7 26394136 missense possibly damaging 0.92
R0391:Nlrp9c UTSW 7 26371476 splice site probably benign
R0433:Nlrp9c UTSW 7 26385819 missense probably benign 0.20
R1035:Nlrp9c UTSW 7 26371277 splice site probably benign
R1118:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1119:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1173:Nlrp9c UTSW 7 26380435 missense probably damaging 1.00
R1519:Nlrp9c UTSW 7 26378101 missense possibly damaging 0.88
R1528:Nlrp9c UTSW 7 26382298 missense probably damaging 0.99
R1616:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1774:Nlrp9c UTSW 7 26394118 missense probably benign 0.05
R1789:Nlrp9c UTSW 7 26380490 missense probably benign 0.00
R1869:Nlrp9c UTSW 7 26384820 nonsense probably null
R1870:Nlrp9c UTSW 7 26384820 nonsense probably null
R1920:Nlrp9c UTSW 7 26384894 missense probably damaging 1.00
R1987:Nlrp9c UTSW 7 26378056 missense probably benign 0.31
R2022:Nlrp9c UTSW 7 26384796 missense probably damaging 1.00
R2309:Nlrp9c UTSW 7 26378087 missense probably damaging 1.00
R2327:Nlrp9c UTSW 7 26375322 missense probably damaging 1.00
R3405:Nlrp9c UTSW 7 26385282 missense probably benign 0.01
R3548:Nlrp9c UTSW 7 26371451 missense probably damaging 1.00
R3846:Nlrp9c UTSW 7 26382276 splice site probably null
R4179:Nlrp9c UTSW 7 26384661 missense possibly damaging 0.74
R4460:Nlrp9c UTSW 7 26378098 missense probably damaging 1.00
R4669:Nlrp9c UTSW 7 26375368 missense possibly damaging 0.90
R4708:Nlrp9c UTSW 7 26384840 missense probably benign 0.07
R4810:Nlrp9c UTSW 7 26378177 splice site probably null
R4824:Nlrp9c UTSW 7 26380564 missense possibly damaging 0.49
R4915:Nlrp9c UTSW 7 26384460 missense probably benign 0.34
R4996:Nlrp9c UTSW 7 26385747 missense possibly damaging 0.92
R5468:Nlrp9c UTSW 7 26365000 missense probably benign 0.00
R5525:Nlrp9c UTSW 7 26384501 missense probably damaging 1.00
R5526:Nlrp9c UTSW 7 26382366 missense possibly damaging 0.95
R6020:Nlrp9c UTSW 7 26384725 missense probably benign 0.08
R6175:Nlrp9c UTSW 7 26378001 splice site probably null
R6454:Nlrp9c UTSW 7 26385774 missense possibly damaging 0.91
R6493:Nlrp9c UTSW 7 26382387 missense probably damaging 1.00
R6649:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6653:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6739:Nlrp9c UTSW 7 26385425 missense probably damaging 0.99
R7097:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7122:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7174:Nlrp9c UTSW 7 26385297 missense probably benign 0.03
R7365:Nlrp9c UTSW 7 26371397 missense possibly damaging 0.93
R7378:Nlrp9c UTSW 7 26365015 missense probably benign 0.14
R7427:Nlrp9c UTSW 7 26371435 missense probably benign 0.00
R7450:Nlrp9c UTSW 7 26364939 missense probably benign 0.45
X0065:Nlrp9c UTSW 7 26380430 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTCTGCAACACTTCCAGGG -3'
(R):5'- GGGCTTATTCCCAATCAGTAGAG -3'

Sequencing Primer
(F):5'- GGGCATGCTCTCCTAGAATAACTC -3'
(R):5'- CCCAATCAGTAGAGCTCTATAAATTC -3'
Posted On2018-10-18