Incidental Mutation 'R6883:Pcolce2'
ID536900
Institutional Source Beutler Lab
Gene Symbol Pcolce2
Ensembl Gene ENSMUSG00000015354
Gene Nameprocollagen C-endopeptidase enhancer 2
Synonyms2400001O18Rik, Pcpe2
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_029620.2; MGI:1923727

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6883 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location95637601-95698096 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 95678343 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000015498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015498] [ENSMUST00000015498]
Predicted Effect probably null
Transcript: ENSMUST00000015498
SMART Domains Protein: ENSMUSP00000015498
Gene: ENSMUSG00000015354

DomainStartEndE-ValueType
CUB 32 143 1.49e-41 SMART
CUB 153 267 2e-42 SMART
low complexity region 268 293 N/A INTRINSIC
C345C 307 412 4.1e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000015498
SMART Domains Protein: ENSMUSP00000015498
Gene: ENSMUSG00000015354

DomainStartEndE-ValueType
CUB 32 143 1.49e-41 SMART
CUB 153 267 2e-42 SMART
low complexity region 268 293 N/A INTRINSIC
C345C 307 412 4.1e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 92% (45/49)
MGI Phenotype Strain: 3722112
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal with no detectable abnormalities in thymus or T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,152,835 H1261L possibly damaging Het
Acaa1b A G 9: 119,156,660 S66P possibly damaging Het
Adh7 A T 3: 138,224,064 E167V probably damaging Het
Ano6 T C 15: 95,962,111 S705P probably damaging Het
Arpc1b T C 5: 145,126,929 V329A probably benign Het
Btla C T 16: 45,242,729 H152Y probably benign Het
Cadps T C 14: 12,465,883 E1009G probably damaging Het
Cttnbp2nl A G 3: 105,011,191 probably null Het
Cyp4a12a G T 4: 115,302,024 V164F probably damaging Het
Duox1 G T 2: 122,324,584 probably null Het
Fmo6 A G 1: 162,929,892 I104T probably damaging Het
Fnbp4 T C 2: 90,745,828 probably null Het
Garem1 T C 18: 21,129,712 T682A probably benign Het
Gm49358 A G 10: 86,815,898 E188G probably benign Het
Gm5773 T C 3: 93,773,855 I278T probably benign Het
Ifi27l2a A G 12: 103,443,497 probably benign Het
Inpp5d A C 1: 87,699,690 K308T probably damaging Het
Irf6 A T 1: 193,167,466 Y232F probably damaging Het
Kcnmb4 T C 10: 116,473,343 Q60R probably benign Het
Klri2 T C 6: 129,733,022 D205G probably benign Het
Mcm9 A T 10: 53,616,014 W352R probably damaging Het
Nat8 A G 6: 85,830,668 V161A possibly damaging Het
Nlrp9c A T 7: 26,378,131 M742K probably benign Het
Olfr1124 C A 2: 87,435,279 T264K probably damaging Het
Olfr1436 C A 19: 12,298,570 Q187H probably damaging Het
Olfr71 T C 4: 43,705,723 T282A possibly damaging Het
Pcdha11 A T 18: 37,011,189 D111V probably damaging Het
Pcdhb6 A T 18: 37,335,145 D373V probably damaging Het
Pik3cb T C 9: 99,101,400 M52V probably benign Het
Pipox T C 11: 77,883,903 E118G probably benign Het
Pou4f2 T C 8: 78,435,678 S99G probably benign Het
Ptpn12 T A 5: 21,055,713 Q12L probably benign Het
Sim2 G T 16: 94,125,536 A540S probably benign Het
Smg1 A T 7: 118,168,180 probably benign Het
Sntb1 A G 15: 55,906,323 V90A probably benign Het
Spns2 T C 11: 72,456,370 probably null Het
Syne1 G T 10: 5,231,704 C4210* probably null Het
Tek T C 4: 94,837,189 I564T possibly damaging Het
Tmem94 T G 11: 115,796,461 C1135W probably damaging Het
Tnxb T A 17: 34,718,519 D3827E probably damaging Het
Ttl A G 2: 129,082,072 D235G possibly damaging Het
Tuba4a A G 1: 75,217,422 S5P probably damaging Het
Uaca T A 9: 60,869,891 V518D probably damaging Het
Unc80 A T 1: 66,646,404 Q2229L probably benign Het
Unkl C T 17: 25,230,333 A78V probably damaging Het
Uroc1 C T 6: 90,338,592 Q152* probably null Het
Vmn2r51 G T 7: 10,100,098 Q338K possibly damaging Het
Vps50 C T 6: 3,498,513 probably benign Het
Other mutations in Pcolce2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Pcolce2 APN 9 95692923 missense probably damaging 0.98
IGL03339:Pcolce2 APN 9 95678340 splice site probably benign
R0019:Pcolce2 UTSW 9 95694964 critical splice acceptor site probably null
R0019:Pcolce2 UTSW 9 95694964 critical splice acceptor site probably null
R0570:Pcolce2 UTSW 9 95638657 missense probably benign 0.00
R0962:Pcolce2 UTSW 9 95670034 missense probably benign 0.04
R0989:Pcolce2 UTSW 9 95638723 missense probably benign 0.00
R1171:Pcolce2 UTSW 9 95694740 missense probably benign 0.01
R1840:Pcolce2 UTSW 9 95670117 missense probably damaging 0.98
R1840:Pcolce2 UTSW 9 95670203 missense probably benign 0.16
R1997:Pcolce2 UTSW 9 95694740 missense probably benign 0.01
R2061:Pcolce2 UTSW 9 95670176 missense probably benign 0.04
R2196:Pcolce2 UTSW 9 95694689 missense probably damaging 0.98
R2287:Pcolce2 UTSW 9 95678405 nonsense probably null
R2922:Pcolce2 UTSW 9 95694714 missense probably damaging 1.00
R4049:Pcolce2 UTSW 9 95638755 missense probably damaging 1.00
R4432:Pcolce2 UTSW 9 95681557 missense probably damaging 0.99
R4639:Pcolce2 UTSW 9 95637877 splice site probably null
R6288:Pcolce2 UTSW 9 95681593 missense probably damaging 0.96
R6625:Pcolce2 UTSW 9 95678439 nonsense probably null
R7023:Pcolce2 UTSW 9 95678468 missense probably benign 0.19
R7066:Pcolce2 UTSW 9 95681621 missense probably benign
R7949:Pcolce2 UTSW 9 95694635 missense probably benign 0.11
R8325:Pcolce2 UTSW 9 95692920 missense probably damaging 1.00
R8369:Pcolce2 UTSW 9 95637794 start codon destroyed probably benign
Z1176:Pcolce2 UTSW 9 95637836 missense possibly damaging 0.83
Z1177:Pcolce2 UTSW 9 95678425 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TACAGAGCAGATTGTGTGGTC -3'
(R):5'- AGGTGGAGGCTCATACCTTG -3'

Sequencing Primer
(F):5'- AGGAGAGCCTCTACCATT -3'
(R):5'- CCTTGGGCAATTCACATAAGAGGC -3'
Posted On2018-10-18