Incidental Mutation 'R6883:Acaa1b'
ID536902
Institutional Source Beutler Lab
Gene Symbol Acaa1b
Ensembl Gene ENSMUSG00000010651
Gene Nameacetyl-Coenzyme A acyltransferase 1B
Synonymsthiolase B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6883 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location119148023-119157093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119156660 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 66 (S66P)
Ref Sequence ENSEMBL: ENSMUSP00000010795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010795] [ENSMUST00000093527]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010795
AA Change: S66P

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000010795
Gene: ENSMUSG00000010651
AA Change: S66P

DomainStartEndE-ValueType
Pfam:Thiolase_N 38 291 6.7e-90 PFAM
Pfam:Thiolase_C 298 421 3e-53 PFAM
Pfam:ACP_syn_III_C 329 420 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093527
SMART Domains Protein: ENSMUSP00000091246
Gene: ENSMUSG00000074029

DomainStartEndE-ValueType
Pfam:DUF3915 11 80 3.1e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 92% (45/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a disruption in this gene appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,152,835 H1261L possibly damaging Het
Adh7 A T 3: 138,224,064 E167V probably damaging Het
Ano6 T C 15: 95,962,111 S705P probably damaging Het
Arpc1b T C 5: 145,126,929 V329A probably benign Het
Btla C T 16: 45,242,729 H152Y probably benign Het
Cadps T C 14: 12,465,883 E1009G probably damaging Het
Cttnbp2nl A G 3: 105,011,191 probably null Het
Cyp4a12a G T 4: 115,302,024 V164F probably damaging Het
Duox1 G T 2: 122,324,584 probably null Het
Fmo6 A G 1: 162,929,892 I104T probably damaging Het
Fnbp4 T C 2: 90,745,828 probably null Het
Garem1 T C 18: 21,129,712 T682A probably benign Het
Gm49358 A G 10: 86,815,898 E188G probably benign Het
Gm5773 T C 3: 93,773,855 I278T probably benign Het
Ifi27l2a A G 12: 103,443,497 probably benign Het
Inpp5d A C 1: 87,699,690 K308T probably damaging Het
Irf6 A T 1: 193,167,466 Y232F probably damaging Het
Kcnmb4 T C 10: 116,473,343 Q60R probably benign Het
Klri2 T C 6: 129,733,022 D205G probably benign Het
Mcm9 A T 10: 53,616,014 W352R probably damaging Het
Nat8 A G 6: 85,830,668 V161A possibly damaging Het
Nlrp9c A T 7: 26,378,131 M742K probably benign Het
Olfr1124 C A 2: 87,435,279 T264K probably damaging Het
Olfr1436 C A 19: 12,298,570 Q187H probably damaging Het
Olfr71 T C 4: 43,705,723 T282A possibly damaging Het
Pcdha11 A T 18: 37,011,189 D111V probably damaging Het
Pcdhb6 A T 18: 37,335,145 D373V probably damaging Het
Pcolce2 A T 9: 95,678,343 probably null Het
Pik3cb T C 9: 99,101,400 M52V probably benign Het
Pipox T C 11: 77,883,903 E118G probably benign Het
Pou4f2 T C 8: 78,435,678 S99G probably benign Het
Ptpn12 T A 5: 21,055,713 Q12L probably benign Het
Sim2 G T 16: 94,125,536 A540S probably benign Het
Smg1 A T 7: 118,168,180 probably benign Het
Sntb1 A G 15: 55,906,323 V90A probably benign Het
Spns2 T C 11: 72,456,370 probably null Het
Syne1 G T 10: 5,231,704 C4210* probably null Het
Tek T C 4: 94,837,189 I564T possibly damaging Het
Tmem94 T G 11: 115,796,461 C1135W probably damaging Het
Tnxb T A 17: 34,718,519 D3827E probably damaging Het
Ttl A G 2: 129,082,072 D235G possibly damaging Het
Tuba4a A G 1: 75,217,422 S5P probably damaging Het
Uaca T A 9: 60,869,891 V518D probably damaging Het
Unc80 A T 1: 66,646,404 Q2229L probably benign Het
Unkl C T 17: 25,230,333 A78V probably damaging Het
Uroc1 C T 6: 90,338,592 Q152* probably null Het
Vmn2r51 G T 7: 10,100,098 Q338K possibly damaging Het
Vps50 C T 6: 3,498,513 probably benign Het
Other mutations in Acaa1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03012:Acaa1b APN 9 119156946 missense probably benign 0.00
R0330:Acaa1b UTSW 9 119153970 missense probably damaging 1.00
R1036:Acaa1b UTSW 9 119150816 unclassified probably benign
R1916:Acaa1b UTSW 9 119156662 missense probably damaging 1.00
R3716:Acaa1b UTSW 9 119156641 missense probably benign 0.06
R4805:Acaa1b UTSW 9 119156946 missense probably benign 0.00
R5535:Acaa1b UTSW 9 119148406 missense probably damaging 1.00
R5732:Acaa1b UTSW 9 119148394 missense possibly damaging 0.81
R7298:Acaa1b UTSW 9 119151847 missense probably benign
R7330:Acaa1b UTSW 9 119148382 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GCCTGATTCAGACCTCTGTG -3'
(R):5'- GCGTCCTTAATTCACTGGGGTG -3'

Sequencing Primer
(F):5'- TCTGTGGTCGAGAGCCCTC -3'
(R):5'- TGGCAAATCGGTGGGACC -3'
Posted On2018-10-18