Incidental Mutation 'R6886:Rnf2'
ID536928
Institutional Source Beutler Lab
Gene Symbol Rnf2
Ensembl Gene ENSMUSG00000026484
Gene Namering finger protein 2
SynonymsdinG, Ring1B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6886 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location151458004-151500955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 151473266 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 34 (N34K)
Ref Sequence ENSEMBL: ENSMUSP00000139676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076110] [ENSMUST00000186415] [ENSMUST00000187048] [ENSMUST00000187991] [ENSMUST00000190070]
Predicted Effect probably benign
Transcript: ENSMUST00000076110
AA Change: N181K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000075476
Gene: ENSMUSG00000026484
AA Change: N181K

DomainStartEndE-ValueType
RING 51 90 1.7e-7 SMART
Pfam:RAWUL 234 330 1.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186415
AA Change: N109K

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140594
Gene: ENSMUSG00000026484
AA Change: N109K

DomainStartEndE-ValueType
RING 51 110 3.24e-4 SMART
PDB:3H8H|A 148 258 4e-78 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000187048
AA Change: N181K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140896
Gene: ENSMUSG00000026484
AA Change: N181K

DomainStartEndE-ValueType
RING 51 90 1.7e-7 SMART
PDB:3H8H|A 220 330 4e-77 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000187991
SMART Domains Protein: ENSMUSP00000140299
Gene: ENSMUSG00000026484

DomainStartEndE-ValueType
Pfam:zf-C3HC4 51 73 2.7e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190070
AA Change: N34K

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139676
Gene: ENSMUSG00000026484
AA Change: N34K

DomainStartEndE-ValueType
Blast:RING 1 35 7e-16 BLAST
PDB:3H8H|A 73 156 2e-56 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polycomb group (PcG) of proteins form the multiprotein complexes that are important for the transcription repression of various genes involved in development and cell proliferation. The protein encoded by this gene is one of the PcG proteins. It has been shown to interact with, and suppress the activity of, transcription factor CP2 (TFCP2/CP2). Studies of the mouse counterpart suggested the involvement of this gene in the specification of anterior-posterior axis, as well as in cell proliferation in early development. This protein was also found to interact with huntingtin interacting protein 2 (HIP2), an ubiquitin-conjugating enzyme, and possess ubiquitin ligase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a null allele show an early growth arrest, failure to progress through gastrulation, impaired epiblast expansion, accumulation of posterior mesoderm and die before E10.5. Mice homozygous for a hypomorphic allele show posterior homeotic transformations of the axial skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,028,690 M44K probably benign Het
Bad T C 19: 6,951,334 probably benign Het
Bbs12 A G 3: 37,319,241 D61G probably damaging Het
Bcr C T 10: 75,153,937 R722C probably damaging Het
Carf C A 1: 60,136,254 probably null Het
Ccdc181 A G 1: 164,280,096 E116G probably damaging Het
Celsr1 A G 15: 86,031,654 V706A probably benign Het
Col9a1 T A 1: 24,185,345 S203T unknown Het
Ctsl T C 13: 64,365,147 probably null Het
Exosc7 A T 9: 123,135,958 E277D probably benign Het
Fam20b A T 1: 156,690,511 W238R probably damaging Het
Fanci A T 7: 79,420,342 H430L possibly damaging Het
Fstl4 A G 11: 53,186,450 D678G probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gm11569 T A 11: 99,798,421 probably benign Het
Gm13084 A G 4: 143,812,762 F54L probably benign Het
Igfn1 G A 1: 135,973,460 R306W probably damaging Het
Il6 C T 5: 30,018,203 probably benign Het
Khdc1c T C 1: 21,369,525 L100P possibly damaging Het
Kif18a G A 2: 109,296,663 R314H probably damaging Het
Kif26b A C 1: 178,874,138 K694T probably damaging Het
Kndc1 A G 7: 139,913,569 T484A probably benign Het
Lonrf1 T C 8: 36,229,037 probably null Het
Man1a2 C T 3: 100,656,071 G169D probably benign Het
Med6 G T 12: 81,591,385 D17E probably damaging Het
Neb T C 2: 52,220,224 K204R probably damaging Het
Nhlrc1 T A 13: 47,013,776 N335I possibly damaging Het
Nlrp12 T C 7: 3,240,683 M400V probably benign Het
Olfr1054 A T 2: 86,333,064 C97* probably null Het
Olfr866 G T 9: 20,027,132 H269N probably benign Het
Pkhd1 C T 1: 20,347,280 S2549N probably benign Het
Rab4b A C 7: 27,172,956 L145R probably damaging Het
Rad50 T C 11: 53,686,184 I526V probably benign Het
Rel T C 11: 23,744,304 H309R probably benign Het
Serpina3m G T 12: 104,389,127 V18F possibly damaging Het
Serpinb9c T C 13: 33,150,327 K244R probably benign Het
Setbp1 T A 18: 78,857,500 Y984F probably damaging Het
Slc12a5 T A 2: 164,982,905 M410K probably benign Het
Smarca4 C T 9: 21,658,831 A710V probably damaging Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Ssrp1 T A 2: 85,039,936 D101E probably benign Het
Tax1bp1 A T 6: 52,733,223 E162D probably benign Het
Tenm4 T A 7: 96,797,392 M823K possibly damaging Het
Tesk1 A G 4: 43,443,592 D53G possibly damaging Het
Tnrc6a T A 7: 123,187,445 S1577T probably benign Het
Tpr A G 1: 150,423,965 I1270V probably benign Het
Trp53bp2 T C 1: 182,429,043 probably null Het
Ube4a A T 9: 44,948,843 I307N probably damaging Het
Unc13b A G 4: 43,170,156 probably benign Het
Vmn2r3 T C 3: 64,259,506 K735E probably damaging Het
Vmn2r54 A G 7: 12,632,153 F285L probably benign Het
Vmn2r81 T G 10: 79,268,154 S204A possibly damaging Het
Washc1 A G 17: 66,119,066 D453G probably damaging Het
Zfp329 T A 7: 12,810,098 I500L probably benign Het
Zfp516 A G 18: 82,957,000 D441G probably benign Het
Zfp644 T C 5: 106,637,911 T257A possibly damaging Het
Other mutations in Rnf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02515:Rnf2 APN 1 151471695 missense probably benign 0.03
R1913:Rnf2 UTSW 1 151476185 missense probably damaging 1.00
R4333:Rnf2 UTSW 1 151473076 missense possibly damaging 0.68
R4965:Rnf2 UTSW 1 151473217 nonsense probably null
R6323:Rnf2 UTSW 1 151473216 missense probably damaging 0.98
R7386:Rnf2 UTSW 1 151471380 missense probably damaging 1.00
R7474:Rnf2 UTSW 1 151471716 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCATAAGAGTTGGATGGGGC -3'
(R):5'- CATGTGGGAATCAGTGACAATG -3'

Sequencing Primer
(F):5'- TGGGGCCTGAAGACTAACTCAATC -3'
(R):5'- TCAGGCACTATGTACACGTG -3'
Posted On2018-10-18