Incidental Mutation 'R6886:Kif26b'
ID536931
Institutional Source Beutler Lab
Gene Symbol Kif26b
Ensembl Gene ENSMUSG00000026494
Gene Namekinesin family member 26B
SynonymsD230039L06Rik, N-11 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6886 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location178529125-178939200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 178874138 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 694 (K694T)
Ref Sequence ENSEMBL: ENSMUSP00000124462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160789] [ENSMUST00000161017]
Predicted Effect probably damaging
Transcript: ENSMUST00000160789
AA Change: K247T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124608
Gene: ENSMUSG00000026494
AA Change: K247T

DomainStartEndE-ValueType
KISc 1 362 2.48e-42 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
low complexity region 460 466 N/A INTRINSIC
low complexity region 560 600 N/A INTRINSIC
low complexity region 652 662 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 1038 1048 N/A INTRINSIC
low complexity region 1294 1322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161017
AA Change: K694T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494
AA Change: K694T

DomainStartEndE-ValueType
low complexity region 58 123 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 220 228 N/A INTRINSIC
Blast:KISc 365 446 4e-8 BLAST
KISc 448 809 2.48e-42 SMART
low complexity region 810 822 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 907 913 N/A INTRINSIC
low complexity region 1007 1047 N/A INTRINSIC
low complexity region 1099 1109 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
low complexity region 1741 1769 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,028,690 M44K probably benign Het
Bad T C 19: 6,951,334 probably benign Het
Bbs12 A G 3: 37,319,241 D61G probably damaging Het
Bcr C T 10: 75,153,937 R722C probably damaging Het
Carf C A 1: 60,136,254 probably null Het
Ccdc181 A G 1: 164,280,096 E116G probably damaging Het
Celsr1 A G 15: 86,031,654 V706A probably benign Het
Col9a1 T A 1: 24,185,345 S203T unknown Het
Ctsl T C 13: 64,365,147 probably null Het
Exosc7 A T 9: 123,135,958 E277D probably benign Het
Fam20b A T 1: 156,690,511 W238R probably damaging Het
Fanci A T 7: 79,420,342 H430L possibly damaging Het
Fstl4 A G 11: 53,186,450 D678G probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gm11569 T A 11: 99,798,421 probably benign Het
Gm13084 A G 4: 143,812,762 F54L probably benign Het
Igfn1 G A 1: 135,973,460 R306W probably damaging Het
Il6 C T 5: 30,018,203 probably benign Het
Khdc1c T C 1: 21,369,525 L100P possibly damaging Het
Kif18a G A 2: 109,296,663 R314H probably damaging Het
Kndc1 A G 7: 139,913,569 T484A probably benign Het
Lonrf1 T C 8: 36,229,037 probably null Het
Man1a2 C T 3: 100,656,071 G169D probably benign Het
Med6 G T 12: 81,591,385 D17E probably damaging Het
Neb T C 2: 52,220,224 K204R probably damaging Het
Nhlrc1 T A 13: 47,013,776 N335I possibly damaging Het
Nlrp12 T C 7: 3,240,683 M400V probably benign Het
Olfr1054 A T 2: 86,333,064 C97* probably null Het
Olfr866 G T 9: 20,027,132 H269N probably benign Het
Pkhd1 C T 1: 20,347,280 S2549N probably benign Het
Rab4b A C 7: 27,172,956 L145R probably damaging Het
Rad50 T C 11: 53,686,184 I526V probably benign Het
Rel T C 11: 23,744,304 H309R probably benign Het
Rnf2 G T 1: 151,473,266 N34K possibly damaging Het
Serpina3m G T 12: 104,389,127 V18F possibly damaging Het
Serpinb9c T C 13: 33,150,327 K244R probably benign Het
Setbp1 T A 18: 78,857,500 Y984F probably damaging Het
Slc12a5 T A 2: 164,982,905 M410K probably benign Het
Smarca4 C T 9: 21,658,831 A710V probably damaging Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Ssrp1 T A 2: 85,039,936 D101E probably benign Het
Tax1bp1 A T 6: 52,733,223 E162D probably benign Het
Tenm4 T A 7: 96,797,392 M823K possibly damaging Het
Tesk1 A G 4: 43,443,592 D53G possibly damaging Het
Tnrc6a T A 7: 123,187,445 S1577T probably benign Het
Tpr A G 1: 150,423,965 I1270V probably benign Het
Trp53bp2 T C 1: 182,429,043 probably null Het
Ube4a A T 9: 44,948,843 I307N probably damaging Het
Unc13b A G 4: 43,170,156 probably benign Het
Vmn2r3 T C 3: 64,259,506 K735E probably damaging Het
Vmn2r54 A G 7: 12,632,153 F285L probably benign Het
Vmn2r81 T G 10: 79,268,154 S204A possibly damaging Het
Washc1 A G 17: 66,119,066 D453G probably damaging Het
Zfp329 T A 7: 12,810,098 I500L probably benign Het
Zfp516 A G 18: 82,957,000 D441G probably benign Het
Zfp644 T C 5: 106,637,911 T257A possibly damaging Het
Other mutations in Kif26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kif26b APN 1 178915648 missense probably damaging 1.00
IGL00425:Kif26b APN 1 178916301 missense probably damaging 0.96
IGL00952:Kif26b APN 1 178932205 missense probably damaging 1.00
IGL01100:Kif26b APN 1 178917244 missense probably benign
IGL01347:Kif26b APN 1 178870675 missense probably damaging 1.00
IGL01543:Kif26b APN 1 178678961 missense probably benign 0.41
IGL01938:Kif26b APN 1 178916038 missense probably damaging 0.99
IGL02100:Kif26b APN 1 178915947 missense probably damaging 0.99
IGL02262:Kif26b APN 1 178916068 missense probably benign 0.05
IGL02576:Kif26b APN 1 178916347 missense probably benign
IGL02673:Kif26b APN 1 178821605 missense probably damaging 1.00
IGL03078:Kif26b APN 1 178870726 missense probably damaging 1.00
IGL03155:Kif26b APN 1 178874128 missense probably damaging 1.00
IGL03157:Kif26b APN 1 178916365 missense probably damaging 1.00
IGL03162:Kif26b APN 1 178916932 missense probably benign
IGL03220:Kif26b APN 1 178864869 missense probably damaging 1.00
IGL03299:Kif26b APN 1 178821560 missense probably benign 0.09
IGL03368:Kif26b APN 1 178916208 missense probably damaging 1.00
IGL03370:Kif26b APN 1 178915381 missense probably benign 0.39
PIT4449001:Kif26b UTSW 1 178918086 missense probably damaging 1.00
R0142:Kif26b UTSW 1 178915389 missense probably damaging 1.00
R0621:Kif26b UTSW 1 178915653 missense probably benign 0.02
R0987:Kif26b UTSW 1 178821620 missense probably damaging 1.00
R1107:Kif26b UTSW 1 178917673 missense probably benign 0.03
R1367:Kif26b UTSW 1 178916463 missense probably damaging 1.00
R1386:Kif26b UTSW 1 178915644 missense probably benign
R1619:Kif26b UTSW 1 178916478 missense probably benign 0.00
R1664:Kif26b UTSW 1 178932139 missense probably damaging 1.00
R2240:Kif26b UTSW 1 178715923 missense probably benign 0.00
R2264:Kif26b UTSW 1 178928842 critical splice acceptor site probably null
R2443:Kif26b UTSW 1 178915014 missense probably damaging 0.99
R3023:Kif26b UTSW 1 178864868 missense probably damaging 0.99
R3744:Kif26b UTSW 1 178679030 missense probably benign 0.00
R3831:Kif26b UTSW 1 178916616 frame shift probably null
R3832:Kif26b UTSW 1 178916616 frame shift probably null
R3833:Kif26b UTSW 1 178916616 frame shift probably null
R3843:Kif26b UTSW 1 178928177 missense probably damaging 1.00
R4108:Kif26b UTSW 1 178916965 missense possibly damaging 0.88
R4181:Kif26b UTSW 1 178915426 missense probably damaging 0.98
R4551:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4552:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4597:Kif26b UTSW 1 178916793 missense probably damaging 1.00
R4599:Kif26b UTSW 1 178530459 missense unknown
R4610:Kif26b UTSW 1 178679355 missense probably damaging 1.00
R4746:Kif26b UTSW 1 178873981 nonsense probably null
R4873:Kif26b UTSW 1 178915327 missense probably benign 0.38
R4875:Kif26b UTSW 1 178915327 missense probably benign 0.38
R5015:Kif26b UTSW 1 178928330 missense probably damaging 0.99
R5060:Kif26b UTSW 1 178530630 missense unknown
R5301:Kif26b UTSW 1 178530668 missense unknown
R5368:Kif26b UTSW 1 178915884 missense probably damaging 1.00
R5387:Kif26b UTSW 1 178914876 missense probably benign 0.01
R5589:Kif26b UTSW 1 178916299 missense probably benign 0.05
R6150:Kif26b UTSW 1 178915546 missense probably damaging 1.00
R6259:Kif26b UTSW 1 178917405 missense probably damaging 0.97
R6355:Kif26b UTSW 1 178916178 missense probably damaging 1.00
R6408:Kif26b UTSW 1 178917568 missense probably damaging 1.00
R6488:Kif26b UTSW 1 178529573 missense unknown
R6546:Kif26b UTSW 1 178928306 missense probably damaging 1.00
R6702:Kif26b UTSW 1 178917287 missense possibly damaging 0.90
R6953:Kif26b UTSW 1 178874072 missense possibly damaging 0.89
R7262:Kif26b UTSW 1 178917654 missense possibly damaging 0.84
R7291:Kif26b UTSW 1 178679046 missense possibly damaging 0.86
R7346:Kif26b UTSW 1 178530741 missense probably damaging 1.00
R7383:Kif26b UTSW 1 178530710 missense probably damaging 1.00
R7448:Kif26b UTSW 1 178914774 missense probably damaging 1.00
R7506:Kif26b UTSW 1 178529499 start gained probably benign
R7562:Kif26b UTSW 1 178914976 missense probably damaging 1.00
R7583:Kif26b UTSW 1 178530445 nonsense probably null
R7585:Kif26b UTSW 1 178916496 missense probably benign 0.01
R7644:Kif26b UTSW 1 178679274 missense probably benign 0.04
R7759:Kif26b UTSW 1 178678944 missense probably damaging 1.00
R7775:Kif26b UTSW 1 178864876 missense probably benign 0.15
R8012:Kif26b UTSW 1 178916250 missense probably benign 0.20
X0021:Kif26b UTSW 1 178928159 missense probably damaging 1.00
X0024:Kif26b UTSW 1 178679082 missense probably benign 0.14
X0025:Kif26b UTSW 1 178915266 nonsense probably null
X0025:Kif26b UTSW 1 178915383 missense possibly damaging 0.70
Z1177:Kif26b UTSW 1 178821548 missense probably benign 0.11
Z1177:Kif26b UTSW 1 178821550 nonsense probably null
Z1177:Kif26b UTSW 1 178915405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCCTGGTTTCAGAAGGAC -3'
(R):5'- AGTGAGCTTGGGCCTATAATC -3'

Sequencing Primer
(F):5'- GAAGGACTTCTGCCTTCCAG -3'
(R):5'- TAAGGGAGGATGCTGCTG -3'
Posted On2018-10-18