Incidental Mutation 'R6886:Olfr1054'
ID536935
Institutional Source Beutler Lab
Gene Symbol Olfr1054
Ensembl Gene ENSMUSG00000075190
Gene Nameolfactory receptor 1054
SynonymsGA_x6K02T2Q125-47811880-47810942, MOR188-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6886 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86332135-86335433 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86333064 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 97 (C97*)
Ref Sequence ENSEMBL: ENSMUSP00000150810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099895] [ENSMUST00000213205]
Predicted Effect probably null
Transcript: ENSMUST00000099895
AA Change: C97*
SMART Domains Protein: ENSMUSP00000097480
Gene: ENSMUSG00000075190
AA Change: C97*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.8e-49 PFAM
Pfam:7tm_1 41 289 5.5e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213205
AA Change: C97*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,028,690 M44K probably benign Het
Bad T C 19: 6,951,334 probably benign Het
Bbs12 A G 3: 37,319,241 D61G probably damaging Het
Bcr C T 10: 75,153,937 R722C probably damaging Het
Carf C A 1: 60,136,254 probably null Het
Ccdc181 A G 1: 164,280,096 E116G probably damaging Het
Celsr1 A G 15: 86,031,654 V706A probably benign Het
Col9a1 T A 1: 24,185,345 S203T unknown Het
Ctsl T C 13: 64,365,147 probably null Het
Exosc7 A T 9: 123,135,958 E277D probably benign Het
Fam20b A T 1: 156,690,511 W238R probably damaging Het
Fanci A T 7: 79,420,342 H430L possibly damaging Het
Fstl4 A G 11: 53,186,450 D678G probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gm11569 T A 11: 99,798,421 probably benign Het
Gm13084 A G 4: 143,812,762 F54L probably benign Het
Igfn1 G A 1: 135,973,460 R306W probably damaging Het
Il6 C T 5: 30,018,203 probably benign Het
Khdc1c T C 1: 21,369,525 L100P possibly damaging Het
Kif18a G A 2: 109,296,663 R314H probably damaging Het
Kif26b A C 1: 178,874,138 K694T probably damaging Het
Kndc1 A G 7: 139,913,569 T484A probably benign Het
Lonrf1 T C 8: 36,229,037 probably null Het
Man1a2 C T 3: 100,656,071 G169D probably benign Het
Med6 G T 12: 81,591,385 D17E probably damaging Het
Neb T C 2: 52,220,224 K204R probably damaging Het
Nhlrc1 T A 13: 47,013,776 N335I possibly damaging Het
Nlrp12 T C 7: 3,240,683 M400V probably benign Het
Olfr866 G T 9: 20,027,132 H269N probably benign Het
Pkhd1 C T 1: 20,347,280 S2549N probably benign Het
Rab4b A C 7: 27,172,956 L145R probably damaging Het
Rad50 T C 11: 53,686,184 I526V probably benign Het
Rel T C 11: 23,744,304 H309R probably benign Het
Rnf2 G T 1: 151,473,266 N34K possibly damaging Het
Serpina3m G T 12: 104,389,127 V18F possibly damaging Het
Serpinb9c T C 13: 33,150,327 K244R probably benign Het
Setbp1 T A 18: 78,857,500 Y984F probably damaging Het
Slc12a5 T A 2: 164,982,905 M410K probably benign Het
Smarca4 C T 9: 21,658,831 A710V probably damaging Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Ssrp1 T A 2: 85,039,936 D101E probably benign Het
Tax1bp1 A T 6: 52,733,223 E162D probably benign Het
Tenm4 T A 7: 96,797,392 M823K possibly damaging Het
Tesk1 A G 4: 43,443,592 D53G possibly damaging Het
Tnrc6a T A 7: 123,187,445 S1577T probably benign Het
Tpr A G 1: 150,423,965 I1270V probably benign Het
Trp53bp2 T C 1: 182,429,043 probably null Het
Ube4a A T 9: 44,948,843 I307N probably damaging Het
Unc13b A G 4: 43,170,156 probably benign Het
Vmn2r3 T C 3: 64,259,506 K735E probably damaging Het
Vmn2r54 A G 7: 12,632,153 F285L probably benign Het
Vmn2r81 T G 10: 79,268,154 S204A possibly damaging Het
Washc1 A G 17: 66,119,066 D453G probably damaging Het
Zfp329 T A 7: 12,810,098 I500L probably benign Het
Zfp516 A G 18: 82,957,000 D441G probably benign Het
Zfp644 T C 5: 106,637,911 T257A possibly damaging Het
Other mutations in Olfr1054
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Olfr1054 APN 2 86332704 nonsense probably null
IGL02266:Olfr1054 APN 2 86332979 missense probably damaging 0.98
IGL02398:Olfr1054 APN 2 86332524 nonsense probably null
IGL02535:Olfr1054 APN 2 86332675 missense probably damaging 1.00
IGL02590:Olfr1054 APN 2 86333000 missense possibly damaging 0.52
IGL02630:Olfr1054 APN 2 86332868 missense probably benign 0.39
PIT4151001:Olfr1054 UTSW 2 86332829 missense possibly damaging 0.60
R0520:Olfr1054 UTSW 2 86333131 missense probably damaging 1.00
R1079:Olfr1054 UTSW 2 86332841 missense probably damaging 0.96
R1887:Olfr1054 UTSW 2 86333273 missense possibly damaging 0.90
R2037:Olfr1054 UTSW 2 86332430 missense probably benign 0.03
R2120:Olfr1054 UTSW 2 86333345 missense probably benign 0.00
R2153:Olfr1054 UTSW 2 86332528 missense probably damaging 1.00
R4523:Olfr1054 UTSW 2 86333300 missense probably benign 0.12
R4836:Olfr1054 UTSW 2 86333227 missense probably benign 0.12
R6147:Olfr1054 UTSW 2 86332500 missense probably damaging 1.00
R6802:Olfr1054 UTSW 2 86333185 missense possibly damaging 0.91
R6894:Olfr1054 UTSW 2 86332951 missense probably damaging 1.00
R7275:Olfr1054 UTSW 2 86332792 missense possibly damaging 0.91
R7322:Olfr1054 UTSW 2 86332564 missense probably benign 0.14
R7325:Olfr1054 UTSW 2 86333000 missense possibly damaging 0.52
R7526:Olfr1054 UTSW 2 86333353 start codon destroyed probably null 1.00
R7976:Olfr1054 UTSW 2 86332720 missense probably benign 0.05
R8421:Olfr1054 UTSW 2 86332903 missense possibly damaging 0.80
R8838:Olfr1054 UTSW 2 86332973 missense possibly damaging 0.61
Z1176:Olfr1054 UTSW 2 86332706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCGCAGAAATGACTAACGATCC -3'
(R):5'- GCAACATGGGCATGATCATC -3'

Sequencing Primer
(F):5'- GAAATGACTAACGATCCTGTAATCAC -3'
(R):5'- ATGGGCATGATCATCCTTACCATGG -3'
Posted On2018-10-18