Incidental Mutation 'R6886:Kif18a'
ID536937
Institutional Source Beutler Lab
Gene Symbol Kif18a
Ensembl Gene ENSMUSG00000027115
Gene Namekinesin family member 18A
SynonymsB130001M12Rik, N-8 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6886 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location109280738-109341747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109296663 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 314 (R314H)
Ref Sequence ENSEMBL: ENSMUSP00000028527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028527]
Predicted Effect probably damaging
Transcript: ENSMUST00000028527
AA Change: R314H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028527
Gene: ENSMUSG00000027115
AA Change: R314H

DomainStartEndE-ValueType
KISc 9 363 8.91e-158 SMART
Blast:KISc 382 433 1e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KIF18A is a member of the kinesin superfamily of microtubule-associated molecular motors (see MIM 148760) that use hydrolysis of ATP to produce force and movement along microtubules (Luboshits and Benayahu, 2005 [PubMed 15878648]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for loss of function alleles exhibit reduced female fertility and male infertility due to primordial germ cell depletion. The sterility phenotype is incompletely penetrant, has variable expressivity, and is modulated by strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,028,690 M44K probably benign Het
Bad T C 19: 6,951,334 probably benign Het
Bbs12 A G 3: 37,319,241 D61G probably damaging Het
Bcr C T 10: 75,153,937 R722C probably damaging Het
Carf C A 1: 60,136,254 probably null Het
Ccdc181 A G 1: 164,280,096 E116G probably damaging Het
Celsr1 A G 15: 86,031,654 V706A probably benign Het
Col9a1 T A 1: 24,185,345 S203T unknown Het
Ctsl T C 13: 64,365,147 probably null Het
Exosc7 A T 9: 123,135,958 E277D probably benign Het
Fam20b A T 1: 156,690,511 W238R probably damaging Het
Fanci A T 7: 79,420,342 H430L possibly damaging Het
Fstl4 A G 11: 53,186,450 D678G probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gm11569 T A 11: 99,798,421 probably benign Het
Gm13084 A G 4: 143,812,762 F54L probably benign Het
Igfn1 G A 1: 135,973,460 R306W probably damaging Het
Il6 C T 5: 30,018,203 probably benign Het
Khdc1c T C 1: 21,369,525 L100P possibly damaging Het
Kif26b A C 1: 178,874,138 K694T probably damaging Het
Kndc1 A G 7: 139,913,569 T484A probably benign Het
Lonrf1 T C 8: 36,229,037 probably null Het
Man1a2 C T 3: 100,656,071 G169D probably benign Het
Med6 G T 12: 81,591,385 D17E probably damaging Het
Neb T C 2: 52,220,224 K204R probably damaging Het
Nhlrc1 T A 13: 47,013,776 N335I possibly damaging Het
Nlrp12 T C 7: 3,240,683 M400V probably benign Het
Olfr1054 A T 2: 86,333,064 C97* probably null Het
Olfr866 G T 9: 20,027,132 H269N probably benign Het
Pkhd1 C T 1: 20,347,280 S2549N probably benign Het
Rab4b A C 7: 27,172,956 L145R probably damaging Het
Rad50 T C 11: 53,686,184 I526V probably benign Het
Rel T C 11: 23,744,304 H309R probably benign Het
Rnf2 G T 1: 151,473,266 N34K possibly damaging Het
Serpina3m G T 12: 104,389,127 V18F possibly damaging Het
Serpinb9c T C 13: 33,150,327 K244R probably benign Het
Setbp1 T A 18: 78,857,500 Y984F probably damaging Het
Slc12a5 T A 2: 164,982,905 M410K probably benign Het
Smarca4 C T 9: 21,658,831 A710V probably damaging Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Ssrp1 T A 2: 85,039,936 D101E probably benign Het
Tax1bp1 A T 6: 52,733,223 E162D probably benign Het
Tenm4 T A 7: 96,797,392 M823K possibly damaging Het
Tesk1 A G 4: 43,443,592 D53G possibly damaging Het
Tnrc6a T A 7: 123,187,445 S1577T probably benign Het
Tpr A G 1: 150,423,965 I1270V probably benign Het
Trp53bp2 T C 1: 182,429,043 probably null Het
Ube4a A T 9: 44,948,843 I307N probably damaging Het
Unc13b A G 4: 43,170,156 probably benign Het
Vmn2r3 T C 3: 64,259,506 K735E probably damaging Het
Vmn2r54 A G 7: 12,632,153 F285L probably benign Het
Vmn2r81 T G 10: 79,268,154 S204A possibly damaging Het
Washc1 A G 17: 66,119,066 D453G probably damaging Het
Zfp329 T A 7: 12,810,098 I500L probably benign Het
Zfp516 A G 18: 82,957,000 D441G probably benign Het
Zfp644 T C 5: 106,637,911 T257A possibly damaging Het
Other mutations in Kif18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Kif18a APN 2 109317988 missense possibly damaging 0.93
IGL00795:Kif18a APN 2 109293020 missense probably damaging 1.00
IGL00904:Kif18a APN 2 109292126 missense probably damaging 1.00
IGL00990:Kif18a APN 2 109334422 missense probably benign 0.01
IGL01323:Kif18a APN 2 109298442 missense probably benign 0.02
IGL01382:Kif18a APN 2 109296766 nonsense probably null
IGL02205:Kif18a APN 2 109307018 splice site probably benign
IGL02207:Kif18a APN 2 109296707 missense probably damaging 0.99
IGL02970:Kif18a APN 2 109287888 missense probably damaging 1.00
IGL03087:Kif18a APN 2 109318117 splice site probably benign
R0030:Kif18a UTSW 2 109333318 missense probably benign
R0482:Kif18a UTSW 2 109287843 start codon destroyed probably null 1.00
R0631:Kif18a UTSW 2 109298322 splice site probably benign
R1597:Kif18a UTSW 2 109292991 missense probably damaging 1.00
R1640:Kif18a UTSW 2 109289816 missense probably benign 0.25
R1675:Kif18a UTSW 2 109298403 missense probably benign
R1723:Kif18a UTSW 2 109302882 missense probably damaging 1.00
R2141:Kif18a UTSW 2 109333503 missense probably benign 0.43
R2142:Kif18a UTSW 2 109333503 missense probably benign 0.43
R2243:Kif18a UTSW 2 109298107 missense probably damaging 1.00
R3609:Kif18a UTSW 2 109338596 missense probably benign 0.02
R3611:Kif18a UTSW 2 109338596 missense probably benign 0.02
R3882:Kif18a UTSW 2 109306974 missense probably benign 0.01
R4292:Kif18a UTSW 2 109298126 missense probably damaging 0.99
R4293:Kif18a UTSW 2 109293053 missense probably benign
R4294:Kif18a UTSW 2 109293053 missense probably benign
R4295:Kif18a UTSW 2 109293053 missense probably benign
R4428:Kif18a UTSW 2 109288121 missense probably damaging 1.00
R4791:Kif18a UTSW 2 109287875 missense probably benign 0.16
R4819:Kif18a UTSW 2 109292126 missense probably damaging 1.00
R5078:Kif18a UTSW 2 109295142 splice site probably benign
R5175:Kif18a UTSW 2 109302978 splice site probably null
R5319:Kif18a UTSW 2 109318025 missense probably benign 0.00
R5821:Kif18a UTSW 2 109289845 splice site probably benign
R5966:Kif18a UTSW 2 109292066 missense probably damaging 1.00
R7069:Kif18a UTSW 2 109295002 missense probably damaging 0.99
R7765:Kif18a UTSW 2 109306940 missense probably benign 0.00
R7801:Kif18a UTSW 2 109287845 missense probably damaging 0.99
R7834:Kif18a UTSW 2 109296774 missense probably damaging 1.00
R7917:Kif18a UTSW 2 109296774 missense probably damaging 1.00
Z1176:Kif18a UTSW 2 109318053 missense possibly damaging 0.63
Z1177:Kif18a UTSW 2 109294957 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCTGCAGATGGGATTTTC -3'
(R):5'- GGCAAATTCCTTGACAGAAACTCC -3'

Sequencing Primer
(F):5'- GCTGCAGATGGGATTTTCAAATATTC -3'
(R):5'- TTGACAGAAACTCCACCATAATTAAG -3'
Posted On2018-10-18