Incidental Mutation 'R6886:Vmn2r3'
ID536940
Institutional Source Beutler Lab
Gene Symbol Vmn2r3
Ensembl Gene ENSMUSG00000091572
Gene Namevomeronasal 2, receptor 3
SynonymsEG637004
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6886 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location64258961-64287495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64259506 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 735 (K735E)
Ref Sequence ENSEMBL: ENSMUSP00000134891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170244] [ENSMUST00000176328]
Predicted Effect probably damaging
Transcript: ENSMUST00000170244
AA Change: K707E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126165
Gene: ENSMUSG00000091572
AA Change: K707E

DomainStartEndE-ValueType
Pfam:ANF_receptor 64 479 4e-64 PFAM
Pfam:NCD3G 521 574 1.1e-17 PFAM
Pfam:7tm_3 605 842 2.9e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176328
AA Change: K735E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134891
Gene: ENSMUSG00000091572
AA Change: K735E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 92 507 9.5e-66 PFAM
Pfam:NCD3G 549 602 8.8e-17 PFAM
Pfam:7tm_3 635 869 8.5e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,028,690 M44K probably benign Het
Bad T C 19: 6,951,334 probably benign Het
Bbs12 A G 3: 37,319,241 D61G probably damaging Het
Bcr C T 10: 75,153,937 R722C probably damaging Het
Carf C A 1: 60,136,254 probably null Het
Ccdc181 A G 1: 164,280,096 E116G probably damaging Het
Celsr1 A G 15: 86,031,654 V706A probably benign Het
Col9a1 T A 1: 24,185,345 S203T unknown Het
Ctsl T C 13: 64,365,147 probably null Het
Exosc7 A T 9: 123,135,958 E277D probably benign Het
Fam20b A T 1: 156,690,511 W238R probably damaging Het
Fanci A T 7: 79,420,342 H430L possibly damaging Het
Fstl4 A G 11: 53,186,450 D678G probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gm11569 T A 11: 99,798,421 probably benign Het
Gm13084 A G 4: 143,812,762 F54L probably benign Het
Igfn1 G A 1: 135,973,460 R306W probably damaging Het
Il6 C T 5: 30,018,203 probably benign Het
Khdc1c T C 1: 21,369,525 L100P possibly damaging Het
Kif18a G A 2: 109,296,663 R314H probably damaging Het
Kif26b A C 1: 178,874,138 K694T probably damaging Het
Kndc1 A G 7: 139,913,569 T484A probably benign Het
Lonrf1 T C 8: 36,229,037 probably null Het
Man1a2 C T 3: 100,656,071 G169D probably benign Het
Med6 G T 12: 81,591,385 D17E probably damaging Het
Neb T C 2: 52,220,224 K204R probably damaging Het
Nhlrc1 T A 13: 47,013,776 N335I possibly damaging Het
Nlrp12 T C 7: 3,240,683 M400V probably benign Het
Olfr1054 A T 2: 86,333,064 C97* probably null Het
Olfr866 G T 9: 20,027,132 H269N probably benign Het
Pkhd1 C T 1: 20,347,280 S2549N probably benign Het
Rab4b A C 7: 27,172,956 L145R probably damaging Het
Rad50 T C 11: 53,686,184 I526V probably benign Het
Rel T C 11: 23,744,304 H309R probably benign Het
Rnf2 G T 1: 151,473,266 N34K possibly damaging Het
Serpina3m G T 12: 104,389,127 V18F possibly damaging Het
Serpinb9c T C 13: 33,150,327 K244R probably benign Het
Setbp1 T A 18: 78,857,500 Y984F probably damaging Het
Slc12a5 T A 2: 164,982,905 M410K probably benign Het
Smarca4 C T 9: 21,658,831 A710V probably damaging Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Ssrp1 T A 2: 85,039,936 D101E probably benign Het
Tax1bp1 A T 6: 52,733,223 E162D probably benign Het
Tenm4 T A 7: 96,797,392 M823K possibly damaging Het
Tesk1 A G 4: 43,443,592 D53G possibly damaging Het
Tnrc6a T A 7: 123,187,445 S1577T probably benign Het
Tpr A G 1: 150,423,965 I1270V probably benign Het
Trp53bp2 T C 1: 182,429,043 probably null Het
Ube4a A T 9: 44,948,843 I307N probably damaging Het
Unc13b A G 4: 43,170,156 probably benign Het
Vmn2r54 A G 7: 12,632,153 F285L probably benign Het
Vmn2r81 T G 10: 79,268,154 S204A possibly damaging Het
Washc1 A G 17: 66,119,066 D453G probably damaging Het
Zfp329 T A 7: 12,810,098 I500L probably benign Het
Zfp516 A G 18: 82,957,000 D441G probably benign Het
Zfp644 T C 5: 106,637,911 T257A possibly damaging Het
Other mutations in Vmn2r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Vmn2r3 APN 3 64259883 missense probably damaging 1.00
IGL01468:Vmn2r3 APN 3 64274961 missense possibly damaging 0.57
IGL02032:Vmn2r3 APN 3 64275055 missense possibly damaging 0.95
IGL02405:Vmn2r3 APN 3 64271199 splice site probably benign
IGL02640:Vmn2r3 APN 3 64287395 missense probably benign
IGL02719:Vmn2r3 APN 3 64275610 missense probably damaging 1.00
IGL02746:Vmn2r3 APN 3 64259818 missense possibly damaging 0.74
IGL02952:Vmn2r3 APN 3 64278835 missense probably damaging 1.00
IGL03390:Vmn2r3 APN 3 64275346 missense possibly damaging 0.55
R0023:Vmn2r3 UTSW 3 64275366 missense probably damaging 0.99
R0433:Vmn2r3 UTSW 3 64275633 missense possibly damaging 0.51
R0647:Vmn2r3 UTSW 3 64275625 missense probably damaging 1.00
R1071:Vmn2r3 UTSW 3 64275276 missense possibly damaging 0.79
R1536:Vmn2r3 UTSW 3 64275117 missense probably damaging 1.00
R1806:Vmn2r3 UTSW 3 64275472 missense probably benign 0.03
R1806:Vmn2r3 UTSW 3 64287389 missense possibly damaging 0.73
R1852:Vmn2r3 UTSW 3 64259394 missense probably damaging 1.00
R1868:Vmn2r3 UTSW 3 64259116 missense probably damaging 1.00
R2072:Vmn2r3 UTSW 3 64275072 missense possibly damaging 0.87
R2240:Vmn2r3 UTSW 3 64259062 missense probably benign 0.44
R2446:Vmn2r3 UTSW 3 64275312 missense probably damaging 0.98
R4133:Vmn2r3 UTSW 3 64275717 missense probably damaging 0.99
R4159:Vmn2r3 UTSW 3 64287429 nonsense probably null
R4494:Vmn2r3 UTSW 3 64275271 missense probably damaging 1.00
R4860:Vmn2r3 UTSW 3 64275601 missense probably benign 0.00
R4895:Vmn2r3 UTSW 3 64259761 missense probably benign 0.00
R4912:Vmn2r3 UTSW 3 64259197 missense probably damaging 1.00
R5018:Vmn2r3 UTSW 3 64271353 missense probably benign
R5033:Vmn2r3 UTSW 3 64259799 missense probably benign 0.09
R5126:Vmn2r3 UTSW 3 64259319 missense probably damaging 1.00
R5148:Vmn2r3 UTSW 3 64278826 missense probably damaging 1.00
R5414:Vmn2r3 UTSW 3 64259557 nonsense probably null
R5785:Vmn2r3 UTSW 3 64259023 missense possibly damaging 0.89
R5905:Vmn2r3 UTSW 3 64275277 missense probably benign 0.19
R5992:Vmn2r3 UTSW 3 64259647 missense probably damaging 1.00
R6028:Vmn2r3 UTSW 3 64275277 missense probably benign 0.19
R6331:Vmn2r3 UTSW 3 64278761 missense probably damaging 1.00
R6378:Vmn2r3 UTSW 3 64275096 missense probably damaging 1.00
R6775:Vmn2r3 UTSW 3 64275618 missense possibly damaging 0.88
R6822:Vmn2r3 UTSW 3 64287455 missense probably benign 0.30
R6826:Vmn2r3 UTSW 3 64274906 nonsense probably null
R6971:Vmn2r3 UTSW 3 64259247 missense probably damaging 0.99
R7154:Vmn2r3 UTSW 3 64287311 missense probably benign 0.02
R7192:Vmn2r3 UTSW 3 64259943 missense probably benign 0.24
R7282:Vmn2r3 UTSW 3 64261404 missense possibly damaging 0.90
R7472:Vmn2r3 UTSW 3 64275532 missense probably benign 0.00
R7563:Vmn2r3 UTSW 3 64275349 missense possibly damaging 0.60
R7726:Vmn2r3 UTSW 3 64275518 nonsense probably null
R8025:Vmn2r3 UTSW 3 64275450 missense possibly damaging 0.91
R8050:Vmn2r3 UTSW 3 64271293 missense probably damaging 0.99
X0022:Vmn2r3 UTSW 3 64271248 missense possibly damaging 0.62
X0022:Vmn2r3 UTSW 3 64274968 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATCTGGCAGCTGACGAGC -3'
(R):5'- CCATGCTATTTATAGGCAAGCC -3'

Sequencing Primer
(F):5'- CTGACGAGCCATAAAGGTTGTAAC -3'
(R):5'- AAGCCATGCAACTGGTCCTG -3'
Posted On2018-10-18