Incidental Mutation 'R6886:Zfp644'
ID536946
Institutional Source Beutler Lab
Gene Symbol Zfp644
Ensembl Gene ENSMUSG00000049606
Gene Namezinc finger protein 644
SynonymsD5Ertd689e, 1110068L01Rik, Zep-2, BM-005
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R6886 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location106616739-106697287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106637911 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 257 (T257A)
Ref Sequence ENSEMBL: ENSMUSP00000114698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045466] [ENSMUST00000112695] [ENSMUST00000112696] [ENSMUST00000112698] [ENSMUST00000122980] [ENSMUST00000124263] [ENSMUST00000127434] [ENSMUST00000135108] [ENSMUST00000137285] [ENSMUST00000155495]
Predicted Effect probably benign
Transcript: ENSMUST00000045466
AA Change: T257A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038047
Gene: ENSMUSG00000049606
AA Change: T257A

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
ZnF_C2H2 928 950 1.07e0 SMART
ZnF_C2H2 1003 1025 1.43e-1 SMART
low complexity region 1199 1212 N/A INTRINSIC
ZnF_C2H2 1226 1252 5.4e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112695
SMART Domains Protein: ENSMUSP00000108315
Gene: ENSMUSG00000049606

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Blast:ZnF_C2H2 39 65 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112696
AA Change: T257A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108316
Gene: ENSMUSG00000049606
AA Change: T257A

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 767 783 N/A INTRINSIC
low complexity region 802 819 N/A INTRINSIC
ZnF_C2H2 959 981 1.07e0 SMART
ZnF_C2H2 1034 1056 1.43e-1 SMART
low complexity region 1230 1243 N/A INTRINSIC
ZnF_C2H2 1257 1283 5.4e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112698
AA Change: T257A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108318
Gene: ENSMUSG00000049606
AA Change: T257A

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
ZnF_C2H2 928 950 1.07e0 SMART
ZnF_C2H2 1003 1025 1.43e-1 SMART
low complexity region 1199 1212 N/A INTRINSIC
ZnF_C2H2 1226 1252 5.4e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122980
Predicted Effect probably benign
Transcript: ENSMUST00000124263
Predicted Effect possibly damaging
Transcript: ENSMUST00000127434
AA Change: T257A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122421
Gene: ENSMUSG00000049606
AA Change: T257A

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135108
Predicted Effect possibly damaging
Transcript: ENSMUST00000137285
AA Change: T257A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000155495
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that may play a role in eye development. Defects in this gene have been associated with high myopia. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,028,690 M44K probably benign Het
Bad T C 19: 6,951,334 probably benign Het
Bbs12 A G 3: 37,319,241 D61G probably damaging Het
Bcr C T 10: 75,153,937 R722C probably damaging Het
Carf C A 1: 60,136,254 probably null Het
Ccdc181 A G 1: 164,280,096 E116G probably damaging Het
Celsr1 A G 15: 86,031,654 V706A probably benign Het
Col9a1 T A 1: 24,185,345 S203T unknown Het
Ctsl T C 13: 64,365,147 probably null Het
Exosc7 A T 9: 123,135,958 E277D probably benign Het
Fam20b A T 1: 156,690,511 W238R probably damaging Het
Fanci A T 7: 79,420,342 H430L possibly damaging Het
Fstl4 A G 11: 53,186,450 D678G probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gm11569 T A 11: 99,798,421 probably benign Het
Gm13084 A G 4: 143,812,762 F54L probably benign Het
Igfn1 G A 1: 135,973,460 R306W probably damaging Het
Il6 C T 5: 30,018,203 probably benign Het
Khdc1c T C 1: 21,369,525 L100P possibly damaging Het
Kif18a G A 2: 109,296,663 R314H probably damaging Het
Kif26b A C 1: 178,874,138 K694T probably damaging Het
Kndc1 A G 7: 139,913,569 T484A probably benign Het
Lonrf1 T C 8: 36,229,037 probably null Het
Man1a2 C T 3: 100,656,071 G169D probably benign Het
Med6 G T 12: 81,591,385 D17E probably damaging Het
Neb T C 2: 52,220,224 K204R probably damaging Het
Nhlrc1 T A 13: 47,013,776 N335I possibly damaging Het
Nlrp12 T C 7: 3,240,683 M400V probably benign Het
Olfr1054 A T 2: 86,333,064 C97* probably null Het
Olfr866 G T 9: 20,027,132 H269N probably benign Het
Pkhd1 C T 1: 20,347,280 S2549N probably benign Het
Rab4b A C 7: 27,172,956 L145R probably damaging Het
Rad50 T C 11: 53,686,184 I526V probably benign Het
Rel T C 11: 23,744,304 H309R probably benign Het
Rnf2 G T 1: 151,473,266 N34K possibly damaging Het
Serpina3m G T 12: 104,389,127 V18F possibly damaging Het
Serpinb9c T C 13: 33,150,327 K244R probably benign Het
Setbp1 T A 18: 78,857,500 Y984F probably damaging Het
Slc12a5 T A 2: 164,982,905 M410K probably benign Het
Smarca4 C T 9: 21,658,831 A710V probably damaging Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Ssrp1 T A 2: 85,039,936 D101E probably benign Het
Tax1bp1 A T 6: 52,733,223 E162D probably benign Het
Tenm4 T A 7: 96,797,392 M823K possibly damaging Het
Tesk1 A G 4: 43,443,592 D53G possibly damaging Het
Tnrc6a T A 7: 123,187,445 S1577T probably benign Het
Tpr A G 1: 150,423,965 I1270V probably benign Het
Trp53bp2 T C 1: 182,429,043 probably null Het
Ube4a A T 9: 44,948,843 I307N probably damaging Het
Unc13b A G 4: 43,170,156 probably benign Het
Vmn2r3 T C 3: 64,259,506 K735E probably damaging Het
Vmn2r54 A G 7: 12,632,153 F285L probably benign Het
Vmn2r81 T G 10: 79,268,154 S204A possibly damaging Het
Washc1 A G 17: 66,119,066 D453G probably damaging Het
Zfp329 T A 7: 12,810,098 I500L probably benign Het
Zfp516 A G 18: 82,957,000 D441G probably benign Het
Other mutations in Zfp644
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Zfp644 APN 5 106638637 critical splice acceptor site probably null
IGL01654:Zfp644 APN 5 106635930 missense probably damaging 1.00
IGL01967:Zfp644 APN 5 106638243 missense probably damaging 1.00
IGL02132:Zfp644 APN 5 106635894 missense probably benign 0.22
IGL02164:Zfp644 APN 5 106638099 missense probably benign 0.01
IGL02303:Zfp644 APN 5 106637314 missense probably damaging 1.00
IGL03091:Zfp644 APN 5 106636858 missense probably damaging 1.00
IGL03102:Zfp644 APN 5 106637268 missense probably damaging 0.99
IGL03298:Zfp644 APN 5 106635101 missense possibly damaging 0.93
PIT4466001:Zfp644 UTSW 5 106636477 missense probably damaging 0.99
R0012:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0012:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0038:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0038:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0058:Zfp644 UTSW 5 106637003 missense possibly damaging 0.69
R0058:Zfp644 UTSW 5 106637003 missense possibly damaging 0.69
R0178:Zfp644 UTSW 5 106636905 missense probably damaging 1.00
R0497:Zfp644 UTSW 5 106638333 missense probably damaging 0.99
R1302:Zfp644 UTSW 5 106634899 missense probably damaging 1.00
R1337:Zfp644 UTSW 5 106637554 missense probably damaging 0.99
R1400:Zfp644 UTSW 5 106637470 unclassified probably null
R1597:Zfp644 UTSW 5 106638333 missense probably damaging 0.99
R1911:Zfp644 UTSW 5 106635271 missense possibly damaging 0.95
R2021:Zfp644 UTSW 5 106635682 missense possibly damaging 0.84
R2196:Zfp644 UTSW 5 106638603 start codon destroyed probably null 0.02
R2256:Zfp644 UTSW 5 106635845 missense probably damaging 1.00
R2311:Zfp644 UTSW 5 106634956 missense probably benign 0.21
R2420:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R2421:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R2422:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R3752:Zfp644 UTSW 5 106636383 missense probably benign
R4207:Zfp644 UTSW 5 106618276 missense probably damaging 1.00
R4285:Zfp644 UTSW 5 106635118 missense probably damaging 1.00
R4874:Zfp644 UTSW 5 106635413 missense probably damaging 1.00
R4961:Zfp644 UTSW 5 106618215 utr 3 prime probably benign
R4984:Zfp644 UTSW 5 106636917 missense possibly damaging 0.96
R5007:Zfp644 UTSW 5 106636001 missense probably benign
R5358:Zfp644 UTSW 5 106635675 missense probably damaging 1.00
R5382:Zfp644 UTSW 5 106634869 missense possibly damaging 0.88
R5416:Zfp644 UTSW 5 106618428 splice site silent
R5641:Zfp644 UTSW 5 106619595 missense probably damaging 1.00
R5656:Zfp644 UTSW 5 106637982 missense probably benign 0.12
R5732:Zfp644 UTSW 5 106637123 missense probably damaging 1.00
R6039:Zfp644 UTSW 5 106635425 missense possibly damaging 0.93
R6039:Zfp644 UTSW 5 106635425 missense possibly damaging 0.93
R6306:Zfp644 UTSW 5 106638124 missense probably damaging 0.99
R6317:Zfp644 UTSW 5 106635845 missense probably damaging 1.00
R6354:Zfp644 UTSW 5 106636753 missense probably benign 0.23
R7223:Zfp644 UTSW 5 106637582 nonsense probably null
R7326:Zfp644 UTSW 5 106638277 missense probably benign 0.12
R7450:Zfp644 UTSW 5 106638526 missense probably benign 0.00
X0011:Zfp644 UTSW 5 106618427 missense probably damaging 1.00
Z1176:Zfp644 UTSW 5 106635744 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTGAGTCACTGTAGCAGTCCTC -3'
(R):5'- GCAAGTCAACACCAAGTTCTG -3'

Sequencing Primer
(F):5'- CACTGTAGCAGTCCTCTGTGTAG -3'
(R):5'- AAAGTACCTACCTCTGCTTTAGTTGG -3'
Posted On2018-10-18