Incidental Mutation 'R6886:Nlrp12'
ID536948
Institutional Source Beutler Lab
Gene Symbol Nlrp12
Ensembl Gene ENSMUSG00000078817
Gene NameNLR family, pyrin domain containing 12
SynonymsNalp12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6886 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location3218784-3249740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3240683 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 400 (M400V)
Ref Sequence ENSEMBL: ENSMUSP00000104293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108653]
Predicted Effect probably benign
Transcript: ENSMUST00000108653
AA Change: M400V

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104293
Gene: ENSMUSG00000078817
AA Change: M400V

DomainStartEndE-ValueType
PYRIN 9 91 1.84e-24 SMART
FISNA 128 201 1.71e-24 SMART
Pfam:NACHT 211 381 4.2e-52 PFAM
LRR 705 732 6.78e-3 SMART
LRR 734 761 2.13e1 SMART
LRR 762 789 3.49e-5 SMART
LRR 791 818 7.02e0 SMART
LRR 819 846 6.52e-5 SMART
LRR 848 875 6.92e-1 SMART
LRR 876 903 2.47e-5 SMART
LRR 905 932 3.78e0 SMART
LRR 933 960 1.63e-5 SMART
LRR 962 989 4.9e0 SMART
LRR 990 1017 1.79e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele have defects in dendritic and myeloid cell migration and a decreased susceptibility to type IV hypersensitivity reactions. Mice homozygous for a second null allele display increased susceptibility to induced colitis and to chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,028,690 M44K probably benign Het
Bad T C 19: 6,951,334 probably benign Het
Bbs12 A G 3: 37,319,241 D61G probably damaging Het
Bcr C T 10: 75,153,937 R722C probably damaging Het
Carf C A 1: 60,136,254 probably null Het
Ccdc181 A G 1: 164,280,096 E116G probably damaging Het
Celsr1 A G 15: 86,031,654 V706A probably benign Het
Col9a1 T A 1: 24,185,345 S203T unknown Het
Ctsl T C 13: 64,365,147 probably null Het
Exosc7 A T 9: 123,135,958 E277D probably benign Het
Fam20b A T 1: 156,690,511 W238R probably damaging Het
Fanci A T 7: 79,420,342 H430L possibly damaging Het
Fstl4 A G 11: 53,186,450 D678G probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gm11569 T A 11: 99,798,421 probably benign Het
Gm13084 A G 4: 143,812,762 F54L probably benign Het
Igfn1 G A 1: 135,973,460 R306W probably damaging Het
Il6 C T 5: 30,018,203 probably benign Het
Khdc1c T C 1: 21,369,525 L100P possibly damaging Het
Kif18a G A 2: 109,296,663 R314H probably damaging Het
Kif26b A C 1: 178,874,138 K694T probably damaging Het
Kndc1 A G 7: 139,913,569 T484A probably benign Het
Lonrf1 T C 8: 36,229,037 probably null Het
Man1a2 C T 3: 100,656,071 G169D probably benign Het
Med6 G T 12: 81,591,385 D17E probably damaging Het
Neb T C 2: 52,220,224 K204R probably damaging Het
Nhlrc1 T A 13: 47,013,776 N335I possibly damaging Het
Olfr1054 A T 2: 86,333,064 C97* probably null Het
Olfr866 G T 9: 20,027,132 H269N probably benign Het
Pkhd1 C T 1: 20,347,280 S2549N probably benign Het
Rab4b A C 7: 27,172,956 L145R probably damaging Het
Rad50 T C 11: 53,686,184 I526V probably benign Het
Rel T C 11: 23,744,304 H309R probably benign Het
Rnf2 G T 1: 151,473,266 N34K possibly damaging Het
Serpina3m G T 12: 104,389,127 V18F possibly damaging Het
Serpinb9c T C 13: 33,150,327 K244R probably benign Het
Setbp1 T A 18: 78,857,500 Y984F probably damaging Het
Slc12a5 T A 2: 164,982,905 M410K probably benign Het
Smarca4 C T 9: 21,658,831 A710V probably damaging Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Ssrp1 T A 2: 85,039,936 D101E probably benign Het
Tax1bp1 A T 6: 52,733,223 E162D probably benign Het
Tenm4 T A 7: 96,797,392 M823K possibly damaging Het
Tesk1 A G 4: 43,443,592 D53G possibly damaging Het
Tnrc6a T A 7: 123,187,445 S1577T probably benign Het
Tpr A G 1: 150,423,965 I1270V probably benign Het
Trp53bp2 T C 1: 182,429,043 probably null Het
Ube4a A T 9: 44,948,843 I307N probably damaging Het
Unc13b A G 4: 43,170,156 probably benign Het
Vmn2r3 T C 3: 64,259,506 K735E probably damaging Het
Vmn2r54 A G 7: 12,632,153 F285L probably benign Het
Vmn2r81 T G 10: 79,268,154 S204A possibly damaging Het
Washc1 A G 17: 66,119,066 D453G probably damaging Het
Zfp329 T A 7: 12,810,098 I500L probably benign Het
Zfp516 A G 18: 82,957,000 D441G probably benign Het
Zfp644 T C 5: 106,637,911 T257A possibly damaging Het
Other mutations in Nlrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Nlrp12 APN 7 3240757 missense probably damaging 1.00
IGL01301:Nlrp12 APN 7 3240092 missense probably damaging 1.00
IGL01346:Nlrp12 APN 7 3240686 missense probably damaging 1.00
IGL01482:Nlrp12 APN 7 3235160 missense possibly damaging 0.65
IGL01534:Nlrp12 APN 7 3239833 missense probably benign 0.03
IGL02106:Nlrp12 APN 7 3233944 missense probably benign 0.02
IGL02159:Nlrp12 APN 7 3249545 utr 5 prime probably benign
IGL02184:Nlrp12 APN 7 3240464 missense probably damaging 0.99
IGL02221:Nlrp12 APN 7 3240967 missense possibly damaging 0.89
IGL02252:Nlrp12 APN 7 3245350 missense probably benign 0.01
ANU18:Nlrp12 UTSW 7 3240092 missense probably damaging 1.00
PIT4280001:Nlrp12 UTSW 7 3241433 missense possibly damaging 0.94
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0090:Nlrp12 UTSW 7 3240034 missense probably damaging 0.99
R0446:Nlrp12 UTSW 7 3234029 missense probably benign 0.00
R0503:Nlrp12 UTSW 7 3249377 missense probably damaging 0.97
R0538:Nlrp12 UTSW 7 3249262 missense possibly damaging 0.56
R1114:Nlrp12 UTSW 7 3228534 missense probably benign
R1680:Nlrp12 UTSW 7 3241174 missense probably damaging 1.00
R2030:Nlrp12 UTSW 7 3228417 missense probably damaging 1.00
R2096:Nlrp12 UTSW 7 3233195 missense probably benign 0.05
R2118:Nlrp12 UTSW 7 3241449 missense probably damaging 1.00
R2266:Nlrp12 UTSW 7 3233945 missense probably benign 0.00
R3615:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R3616:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R4375:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4376:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4379:Nlrp12 UTSW 7 3239924 missense probably benign 0.08
R4837:Nlrp12 UTSW 7 3231061 missense probably damaging 1.00
R4856:Nlrp12 UTSW 7 3240442 missense probably damaging 1.00
R4970:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5112:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5147:Nlrp12 UTSW 7 3241373 missense possibly damaging 0.79
R5505:Nlrp12 UTSW 7 3249385 missense probably damaging 0.99
R5636:Nlrp12 UTSW 7 3225294 missense probably damaging 0.99
R5891:Nlrp12 UTSW 7 3219259 utr 3 prime probably benign
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6365:Nlrp12 UTSW 7 3239888 missense probably benign 0.00
R6383:Nlrp12 UTSW 7 3234043 missense probably damaging 1.00
R6796:Nlrp12 UTSW 7 3241409 missense probably damaging 1.00
R6957:Nlrp12 UTSW 7 3222486 missense probably damaging 1.00
R6995:Nlrp12 UTSW 7 3239851 missense probably benign
R7340:Nlrp12 UTSW 7 3233125 missense possibly damaging 0.93
R7346:Nlrp12 UTSW 7 3249257 missense probably damaging 0.96
R7387:Nlrp12 UTSW 7 3241201 missense probably damaging 0.97
R7414:Nlrp12 UTSW 7 3241347 missense probably benign 0.01
R7432:Nlrp12 UTSW 7 3222539 missense probably benign 0.14
R7729:Nlrp12 UTSW 7 3228388 critical splice donor site probably null
R7793:Nlrp12 UTSW 7 3245400 missense probably benign
X0064:Nlrp12 UTSW 7 3241386 missense probably benign 0.14
X0065:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
Z1088:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Z1176:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Z1177:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGCCGTGTTTCCCAAGATC -3'
(R):5'- ATTCGGAGGTTGCTTCTGCC -3'

Sequencing Primer
(F):5'- TCTGCAGCCAGAGAGACCAG -3'
(R):5'- AGGTTGCTTCTGCCCCAGG -3'
Posted On2018-10-18