Incidental Mutation 'R6886:Tnrc6a'
ID536954
Institutional Source Beutler Lab
Gene Symbol Tnrc6a
Ensembl Gene ENSMUSG00000052707
Gene Nametrinucleotide repeat containing 6a
SynonymsCAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik
MMRRC Submission
Accession Numbers

Genbank: NM_144925; MGI: 2385292

Is this an essential gene? Probably essential (E-score: 0.820) question?
Stock #R6886 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location123123885-123195296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123187445 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1577 (S1577T)
Ref Sequence ENSEMBL: ENSMUSP00000091595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514]
Predicted Effect probably benign
Transcript: ENSMUST00000094053
AA Change: S1577T

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: S1577T

DomainStartEndE-ValueType
coiled coil region 5 54 N/A INTRINSIC
low complexity region 69 92 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
low complexity region 430 443 N/A INTRINSIC
low complexity region 568 590 N/A INTRINSIC
internal_repeat_1 690 853 3.51e-6 PROSPERO
low complexity region 858 871 N/A INTRINSIC
Pfam:Ago_hook 1028 1190 1.2e-29 PFAM
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1301 1316 N/A INTRINSIC
low complexity region 1337 1376 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1439 1714 1.5e-126 PFAM
RRM 1717 1784 4.95e-2 SMART
low complexity region 1808 1820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205514
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,028,690 M44K probably benign Het
Bad T C 19: 6,951,334 probably benign Het
Bbs12 A G 3: 37,319,241 D61G probably damaging Het
Bcr C T 10: 75,153,937 R722C probably damaging Het
Carf C A 1: 60,136,254 probably null Het
Ccdc181 A G 1: 164,280,096 E116G probably damaging Het
Celsr1 A G 15: 86,031,654 V706A probably benign Het
Col9a1 T A 1: 24,185,345 S203T unknown Het
Ctsl T C 13: 64,365,147 probably null Het
Exosc7 A T 9: 123,135,958 E277D probably benign Het
Fam20b A T 1: 156,690,511 W238R probably damaging Het
Fanci A T 7: 79,420,342 H430L possibly damaging Het
Fstl4 A G 11: 53,186,450 D678G probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gm11569 T A 11: 99,798,421 probably benign Het
Gm13084 A G 4: 143,812,762 F54L probably benign Het
Igfn1 G A 1: 135,973,460 R306W probably damaging Het
Il6 C T 5: 30,018,203 probably benign Het
Khdc1c T C 1: 21,369,525 L100P possibly damaging Het
Kif18a G A 2: 109,296,663 R314H probably damaging Het
Kif26b A C 1: 178,874,138 K694T probably damaging Het
Kndc1 A G 7: 139,913,569 T484A probably benign Het
Lonrf1 T C 8: 36,229,037 probably null Het
Man1a2 C T 3: 100,656,071 G169D probably benign Het
Med6 G T 12: 81,591,385 D17E probably damaging Het
Neb T C 2: 52,220,224 K204R probably damaging Het
Nhlrc1 T A 13: 47,013,776 N335I possibly damaging Het
Nlrp12 T C 7: 3,240,683 M400V probably benign Het
Olfr1054 A T 2: 86,333,064 C97* probably null Het
Olfr866 G T 9: 20,027,132 H269N probably benign Het
Pkhd1 C T 1: 20,347,280 S2549N probably benign Het
Rab4b A C 7: 27,172,956 L145R probably damaging Het
Rad50 T C 11: 53,686,184 I526V probably benign Het
Rel T C 11: 23,744,304 H309R probably benign Het
Rnf2 G T 1: 151,473,266 N34K possibly damaging Het
Serpina3m G T 12: 104,389,127 V18F possibly damaging Het
Serpinb9c T C 13: 33,150,327 K244R probably benign Het
Setbp1 T A 18: 78,857,500 Y984F probably damaging Het
Slc12a5 T A 2: 164,982,905 M410K probably benign Het
Smarca4 C T 9: 21,658,831 A710V probably damaging Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Ssrp1 T A 2: 85,039,936 D101E probably benign Het
Tax1bp1 A T 6: 52,733,223 E162D probably benign Het
Tenm4 T A 7: 96,797,392 M823K possibly damaging Het
Tesk1 A G 4: 43,443,592 D53G possibly damaging Het
Tpr A G 1: 150,423,965 I1270V probably benign Het
Trp53bp2 T C 1: 182,429,043 probably null Het
Ube4a A T 9: 44,948,843 I307N probably damaging Het
Unc13b A G 4: 43,170,156 probably benign Het
Vmn2r3 T C 3: 64,259,506 K735E probably damaging Het
Vmn2r54 A G 7: 12,632,153 F285L probably benign Het
Vmn2r81 T G 10: 79,268,154 S204A possibly damaging Het
Washc1 A G 17: 66,119,066 D453G probably damaging Het
Zfp329 T A 7: 12,810,098 I500L probably benign Het
Zfp516 A G 18: 82,957,000 D441G probably benign Het
Zfp644 T C 5: 106,637,911 T257A possibly damaging Het
Other mutations in Tnrc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Tnrc6a APN 7 123170780 missense probably benign 0.04
IGL00580:Tnrc6a APN 7 123174278 missense probably damaging 1.00
IGL01309:Tnrc6a APN 7 123171494 missense probably benign 0.04
IGL02004:Tnrc6a APN 7 123181366 missense possibly damaging 0.57
IGL02142:Tnrc6a APN 7 123152191 intron probably benign
IGL02220:Tnrc6a APN 7 123170456 missense probably benign
IGL02436:Tnrc6a APN 7 123184215 nonsense probably null
IGL02670:Tnrc6a APN 7 123171312 missense possibly damaging 0.92
IGL02743:Tnrc6a APN 7 123171473 missense probably damaging 1.00
0152:Tnrc6a UTSW 7 123180654 missense probably damaging 1.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0369:Tnrc6a UTSW 7 123170860 missense probably damaging 1.00
R0512:Tnrc6a UTSW 7 123186728 splice site probably benign
R0566:Tnrc6a UTSW 7 123170913 missense probably benign 0.00
R0600:Tnrc6a UTSW 7 123171816 missense probably benign 0.14
R0751:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1184:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1319:Tnrc6a UTSW 7 123184251 missense probably benign 0.02
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1585:Tnrc6a UTSW 7 123176875 missense probably benign 0.08
R1709:Tnrc6a UTSW 7 123169982 missense probably benign 0.10
R1776:Tnrc6a UTSW 7 123171297 missense probably damaging 1.00
R1791:Tnrc6a UTSW 7 123192917 missense possibly damaging 0.47
R1807:Tnrc6a UTSW 7 123162446 splice site probably benign
R1876:Tnrc6a UTSW 7 123162446 splice site probably benign
R2010:Tnrc6a UTSW 7 123171046 missense probably benign 0.26
R2086:Tnrc6a UTSW 7 123162446 splice site probably benign
R2089:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2511:Tnrc6a UTSW 7 123171092 missense probably damaging 1.00
R2830:Tnrc6a UTSW 7 123192949 makesense probably null
R2850:Tnrc6a UTSW 7 123179800 missense probably damaging 1.00
R3916:Tnrc6a UTSW 7 123181384 missense probably damaging 1.00
R4028:Tnrc6a UTSW 7 123170121 missense probably damaging 1.00
R4235:Tnrc6a UTSW 7 123171680 missense probably benign 0.00
R4439:Tnrc6a UTSW 7 123152182 nonsense probably null
R4525:Tnrc6a UTSW 7 123179782 missense probably benign
R4578:Tnrc6a UTSW 7 123184221 missense possibly damaging 0.89
R4613:Tnrc6a UTSW 7 123184289 critical splice donor site probably null
R4711:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R4722:Tnrc6a UTSW 7 123192090 missense possibly damaging 0.78
R4746:Tnrc6a UTSW 7 123189997 missense probably damaging 1.00
R4892:Tnrc6a UTSW 7 123169911 missense probably damaging 1.00
R4942:Tnrc6a UTSW 7 123192613 missense probably damaging 0.99
R4967:Tnrc6a UTSW 7 123189872 missense probably damaging 1.00
R5064:Tnrc6a UTSW 7 123186723 critical splice donor site probably null
R5239:Tnrc6a UTSW 7 123186619 missense probably benign
R5604:Tnrc6a UTSW 7 123174236 missense probably damaging 0.97
R5805:Tnrc6a UTSW 7 123170076 missense probably damaging 0.97
R5942:Tnrc6a UTSW 7 123186665 missense probably damaging 1.00
R5988:Tnrc6a UTSW 7 123182380 missense probably damaging 0.96
R6212:Tnrc6a UTSW 7 123143742 splice site probably null
R6284:Tnrc6a UTSW 7 123171335 missense probably damaging 0.99
R6417:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6420:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6575:Tnrc6a UTSW 7 123169910 missense probably damaging 1.00
R6760:Tnrc6a UTSW 7 123171999 missense probably damaging 1.00
R6968:Tnrc6a UTSW 7 123182427 missense probably benign 0.05
R7216:Tnrc6a UTSW 7 123171495 missense probably benign 0.01
R7260:Tnrc6a UTSW 7 123186590 missense probably benign 0.36
R7299:Tnrc6a UTSW 7 123170913 missense probably benign
R7322:Tnrc6a UTSW 7 123171508 missense probably benign 0.09
R7500:Tnrc6a UTSW 7 123173450 intron probably null
R7872:Tnrc6a UTSW 7 123179834 missense probably damaging 0.99
R7955:Tnrc6a UTSW 7 123179834 missense probably damaging 0.99
X0064:Tnrc6a UTSW 7 123169798 missense probably benign 0.28
Z1176:Tnrc6a UTSW 7 123162496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGTTGTTACCAGCCTGGCC -3'
(R):5'- GAATGGATTGAAGGGGCTGTCC -3'

Sequencing Primer
(F):5'- TACCAGCCTGGCCTTTTAGGG -3'
(R):5'- AAGGGGCTGTCCTGTGC -3'
Posted On2018-10-18