Mutagenetix > Incidental Mutations

Incidental Mutation 'R6886:Snx19'

536960

Institutional Source

Beutler Lab

Gene Symbol

Snx19

Ensembl Gene

ENSMUSG00000031993

Gene Name

sorting nexin 19

Synonyms

3526401K03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R6886 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30427108-30466733 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 30428935 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 456 (D456E)

Ref Sequence

ENSEMBL: ENSMUSP00000131895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164099]

Predicted Effect

probably damaging
Transcript: ENSMUST00000164099
AA Change: D456E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000131895
Gene: ENSMUSG00000031993
AA Change: D456E

Domain	Start	End	E-Value	Type
transmembrane domain	29	46	N/A	INTRINSIC
transmembrane domain	51	73	N/A	INTRINSIC
Pfam:PXA	96	269	2.9e-43	PFAM
low complexity region	324	335	N/A	INTRINSIC
low complexity region	371	385	N/A	INTRINSIC
low complexity region	504	528	N/A	INTRINSIC
PX	533	664	1.83e-24	SMART
Pfam:Nexin_C	843	951	1.9e-23	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Islet antigen-2 (IA-2) is an autoantigen in type 1 diabetes and plays a role in insulin secretion. IA-2 is found in dense-core secretory vesicles and interacts with the product of this gene, a sorting nexin. In mouse pancreatic beta-cells, the encoded protein influenced insulin secretion by stabilizing the number of dense-core secretory vesicles. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp7b	A	T	8: 22,028,690	M44K	probably benign	Het
Bad	T	C	19: 6,951,334		probably benign	Het
Bbs12	A	G	3: 37,319,241	D61G	probably damaging	Het
Bcr	C	T	10: 75,153,937	R722C	probably damaging	Het
Carf	C	A	1: 60,136,254		probably null	Het
Ccdc181	A	G	1: 164,280,096	E116G	probably damaging	Het
Celsr1	A	G	15: 86,031,654	V706A	probably benign	Het
Col9a1	T	A	1: 24,185,345	S203T	unknown	Het
Ctsl	T	C	13: 64,365,147		probably null	Het
Exosc7	A	T	9: 123,135,958	E277D	probably benign	Het
Fam20b	A	T	1: 156,690,511	W238R	probably damaging	Het
Fanci	A	T	7: 79,420,342	H430L	possibly damaging	Het
Fstl4	A	G	11: 53,186,450	D678G	probably damaging	Het
Gm10801	TC	TCGGC	2: 98,663,806		probably benign	Het
Gm11569	T	A	11: 99,798,421		probably benign	Het
Gm13084	A	G	4: 143,812,762	F54L	probably benign	Het
Igfn1	G	A	1: 135,973,460	R306W	probably damaging	Het
Il6	C	T	5: 30,018,203		probably benign	Het
Khdc1c	T	C	1: 21,369,525	L100P	possibly damaging	Het
Kif18a	G	A	2: 109,296,663	R314H	probably damaging	Het
Kif26b	A	C	1: 178,874,138	K694T	probably damaging	Het
Kndc1	A	G	7: 139,913,569	T484A	probably benign	Het
Lonrf1	T	C	8: 36,229,037		probably null	Het
Man1a2	C	T	3: 100,656,071	G169D	probably benign	Het
Med6	G	T	12: 81,591,385	D17E	probably damaging	Het
Neb	T	C	2: 52,220,224	K204R	probably damaging	Het
Nhlrc1	T	A	13: 47,013,776	N335I	possibly damaging	Het
Nlrp12	T	C	7: 3,240,683	M400V	probably benign	Het
Olfr1054	A	T	2: 86,333,064	C97*	probably null	Het
Olfr866	G	T	9: 20,027,132	H269N	probably benign	Het
Pkhd1	C	T	1: 20,347,280	S2549N	probably benign	Het
Rab4b	A	C	7: 27,172,956	L145R	probably damaging	Het
Rad50	T	C	11: 53,686,184	I526V	probably benign	Het
Rel	T	C	11: 23,744,304	H309R	probably benign	Het
Rnf2	G	T	1: 151,473,266	N34K	possibly damaging	Het
Serpina3m	G	T	12: 104,389,127	V18F	possibly damaging	Het
Serpinb9c	T	C	13: 33,150,327	K244R	probably benign	Het
Setbp1	T	A	18: 78,857,500	Y984F	probably damaging	Het
Slc12a5	T	A	2: 164,982,905	M410K	probably benign	Het
Smarca4	C	T	9: 21,658,831	A710V	probably damaging	Het
Ssrp1	T	A	2: 85,039,936	D101E	probably benign	Het
Tax1bp1	A	T	6: 52,733,223	E162D	probably benign	Het
Tenm4	T	A	7: 96,797,392	M823K	possibly damaging	Het
Tesk1	A	G	4: 43,443,592	D53G	possibly damaging	Het
Tnrc6a	T	A	7: 123,187,445	S1577T	probably benign	Het
Tpr	A	G	1: 150,423,965	I1270V	probably benign	Het
Trp53bp2	T	C	1: 182,429,043		probably null	Het
Ube4a	A	T	9: 44,948,843	I307N	probably damaging	Het
Unc13b	A	G	4: 43,170,156		probably benign	Het
Vmn2r3	T	C	3: 64,259,506	K735E	probably damaging	Het
Vmn2r54	A	G	7: 12,632,153	F285L	probably benign	Het
Vmn2r81	T	G	10: 79,268,154	S204A	possibly damaging	Het
Washc1	A	G	17: 66,119,066	D453G	probably damaging	Het
Zfp329	T	A	7: 12,810,098	I500L	probably benign	Het
Zfp516	A	G	18: 82,957,000	D441G	probably benign	Het
Zfp644	T	C	5: 106,637,911	T257A	possibly damaging	Het

Other mutations in Snx19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Snx19	APN	9	30429084	missense	possibly damaging	0.92
IGL00498:Snx19	APN	9	30428937	missense	possibly damaging	0.92
IGL00718:Snx19	APN	9	30432326	missense	probably damaging	1.00
IGL00902:Snx19	APN	9	30428732	missense	possibly damaging	0.90
IGL01433:Snx19	APN	9	30428771	missense	possibly damaging	0.93
IGL01668:Snx19	APN	9	30427823	missense	probably benign
IGL01732:Snx19	APN	9	30462353	missense	probably damaging	1.00
IGL01767:Snx19	APN	9	30463264	missense	possibly damaging	0.95
IGL02638:Snx19	APN	9	30432364	missense	possibly damaging	0.52
IGL02718:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02719:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02723:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02724:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02725:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02892:Snx19	APN	9	30428364	missense	probably damaging	1.00
IGL03061:Snx19	APN	9	30433632	missense	probably damaging	0.99
IGL03402:Snx19	APN	9	30440134	missense	possibly damaging	0.89
R0125:Snx19	UTSW	9	30440219	missense	probably damaging	1.00
R0133:Snx19	UTSW	9	30428616	missense	possibly damaging	0.94
R0196:Snx19	UTSW	9	30433387	missense	probably damaging	1.00
R0423:Snx19	UTSW	9	30435837	missense	probably damaging	1.00
R0635:Snx19	UTSW	9	30428810	missense	probably damaging	1.00
R0635:Snx19	UTSW	9	30428811	missense	probably damaging	1.00
R1068:Snx19	UTSW	9	30429018	missense	probably damaging	0.99
R1570:Snx19	UTSW	9	30428343	missense	probably damaging	1.00
R1727:Snx19	UTSW	9	30433366	missense	probably damaging	1.00
R1895:Snx19	UTSW	9	30432324	missense	probably damaging	1.00
R1907:Snx19	UTSW	9	30433576	missense	probably damaging	0.99
R1946:Snx19	UTSW	9	30432324	missense	probably damaging	1.00
R1989:Snx19	UTSW	9	30428108	missense	possibly damaging	0.93
R2029:Snx19	UTSW	9	30429000	missense	probably benign	0.01
R2914:Snx19	UTSW	9	30433532	unclassified	probably benign
R3880:Snx19	UTSW	9	30462392	missense	probably damaging	1.00
R4223:Snx19	UTSW	9	30428448	missense	possibly damaging	0.95
R4415:Snx19	UTSW	9	30437483	missense	probably damaging	0.99
R4438:Snx19	UTSW	9	30428599	missense	probably benign	0.01
R4484:Snx19	UTSW	9	30427896	missense	probably benign	0.01
R4585:Snx19	UTSW	9	30440195	missense	probably damaging	1.00
R4765:Snx19	UTSW	9	30440157	missense	probably damaging	1.00
R4771:Snx19	UTSW	9	30433638	missense	probably damaging	1.00
R4922:Snx19	UTSW	9	30437467	missense	probably benign	0.25
R5096:Snx19	UTSW	9	30428786	missense	probably benign	0.40
R5464:Snx19	UTSW	9	30427973	missense	possibly damaging	0.54
R6469:Snx19	UTSW	9	30427743	missense	possibly damaging	0.50
R6988:Snx19	UTSW	9	30428935	missense	probably damaging	1.00
R7131:Snx19	UTSW	9	30427893	missense	probably damaging	1.00
R7268:Snx19	UTSW	9	30440177	missense	probably damaging	1.00
R7772:Snx19	UTSW	9	30428925	missense	probably damaging	0.99
X0019:Snx19	UTSW	9	30437366	missense	probably damaging	1.00
X0024:Snx19	UTSW	9	30427721	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ACAGGATTCAAGATGCTCTGTG -3'
(R):5'- TCGAAGGTTCTGGATGACAACC -3'

Sequencing Primer
(F):5'- AAGATGCTCTGTGTGCCCTAGAC -3'
(R):5'- ACTGCTCAGGGACTCGAAG -3'

Posted On

2018-10-18