Incidental Mutation 'R6886:Bcr'
ID536963
Institutional Source Beutler Lab
Gene Symbol Bcr
Ensembl Gene ENSMUSG00000009681
Gene Namebreakpoint cluster region
Synonyms5133400C09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R6886 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location75060592-75184921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75153937 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 722 (R722C)
Ref Sequence ENSEMBL: ENSMUSP00000126377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164107]
Predicted Effect probably damaging
Transcript: ENSMUST00000164107
AA Change: R722C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126377
Gene: ENSMUSG00000009681
AA Change: R722C

DomainStartEndE-ValueType
Pfam:Bcr-Abl_Oligo 3 75 1.2e-44 PFAM
low complexity region 86 109 N/A INTRINSIC
low complexity region 121 147 N/A INTRINSIC
low complexity region 342 358 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
RhoGEF 501 689 6.22e-51 SMART
PH 708 867 7.95e-8 SMART
C2 911 1016 2.85e-11 SMART
RhoGAP 1064 1248 6.42e-70 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A reciprocal translocation between chromosomes 22 and 9 produces the Philadelphia chromosome, which is often found in patients with chronic myelogenous leukemia. The chromosome 22 breakpoint for this translocation is located within the BCR gene. The translocation produces a fusion protein which is encoded by sequence from both BCR and ABL, the gene at the chromosome 9 breakpoint. Although the BCR-ABL fusion protein has been extensively studied, the function of the normal BCR gene product is not clear. The protein has serine/threonine kinase activity and is a GTPase-activating protein for p21rac. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are defective in hormonal and behavioral stress response regulation and prone to septic shock, whereas chimeric mice carrying a BCR-ABL fusion mutation mimicking human Philadelphia chromosome develop chronic myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,028,690 M44K probably benign Het
Bad T C 19: 6,951,334 probably benign Het
Bbs12 A G 3: 37,319,241 D61G probably damaging Het
Carf C A 1: 60,136,254 probably null Het
Ccdc181 A G 1: 164,280,096 E116G probably damaging Het
Celsr1 A G 15: 86,031,654 V706A probably benign Het
Col9a1 T A 1: 24,185,345 S203T unknown Het
Ctsl T C 13: 64,365,147 probably null Het
Exosc7 A T 9: 123,135,958 E277D probably benign Het
Fam20b A T 1: 156,690,511 W238R probably damaging Het
Fanci A T 7: 79,420,342 H430L possibly damaging Het
Fstl4 A G 11: 53,186,450 D678G probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gm11569 T A 11: 99,798,421 probably benign Het
Gm13084 A G 4: 143,812,762 F54L probably benign Het
Igfn1 G A 1: 135,973,460 R306W probably damaging Het
Il6 C T 5: 30,018,203 probably benign Het
Khdc1c T C 1: 21,369,525 L100P possibly damaging Het
Kif18a G A 2: 109,296,663 R314H probably damaging Het
Kif26b A C 1: 178,874,138 K694T probably damaging Het
Kndc1 A G 7: 139,913,569 T484A probably benign Het
Lonrf1 T C 8: 36,229,037 probably null Het
Man1a2 C T 3: 100,656,071 G169D probably benign Het
Med6 G T 12: 81,591,385 D17E probably damaging Het
Neb T C 2: 52,220,224 K204R probably damaging Het
Nhlrc1 T A 13: 47,013,776 N335I possibly damaging Het
Nlrp12 T C 7: 3,240,683 M400V probably benign Het
Olfr1054 A T 2: 86,333,064 C97* probably null Het
Olfr866 G T 9: 20,027,132 H269N probably benign Het
Pkhd1 C T 1: 20,347,280 S2549N probably benign Het
Rab4b A C 7: 27,172,956 L145R probably damaging Het
Rad50 T C 11: 53,686,184 I526V probably benign Het
Rel T C 11: 23,744,304 H309R probably benign Het
Rnf2 G T 1: 151,473,266 N34K possibly damaging Het
Serpina3m G T 12: 104,389,127 V18F possibly damaging Het
Serpinb9c T C 13: 33,150,327 K244R probably benign Het
Setbp1 T A 18: 78,857,500 Y984F probably damaging Het
Slc12a5 T A 2: 164,982,905 M410K probably benign Het
Smarca4 C T 9: 21,658,831 A710V probably damaging Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Ssrp1 T A 2: 85,039,936 D101E probably benign Het
Tax1bp1 A T 6: 52,733,223 E162D probably benign Het
Tenm4 T A 7: 96,797,392 M823K possibly damaging Het
Tesk1 A G 4: 43,443,592 D53G possibly damaging Het
Tnrc6a T A 7: 123,187,445 S1577T probably benign Het
Tpr A G 1: 150,423,965 I1270V probably benign Het
Trp53bp2 T C 1: 182,429,043 probably null Het
Ube4a A T 9: 44,948,843 I307N probably damaging Het
Unc13b A G 4: 43,170,156 probably benign Het
Vmn2r3 T C 3: 64,259,506 K735E probably damaging Het
Vmn2r54 A G 7: 12,632,153 F285L probably benign Het
Vmn2r81 T G 10: 79,268,154 S204A possibly damaging Het
Washc1 A G 17: 66,119,066 D453G probably damaging Het
Zfp329 T A 7: 12,810,098 I500L probably benign Het
Zfp516 A G 18: 82,957,000 D441G probably benign Het
Zfp644 T C 5: 106,637,911 T257A possibly damaging Het
Other mutations in Bcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bcr APN 10 75157071 unclassified probably benign
IGL00662:Bcr APN 10 75168100 splice site probably benign
IGL01359:Bcr APN 10 75159779 unclassified probably benign
IGL01737:Bcr APN 10 75154951 missense probably damaging 0.99
IGL01908:Bcr APN 10 75061873 missense possibly damaging 0.85
IGL01954:Bcr APN 10 75175341 splice site probably null
IGL02169:Bcr APN 10 75159882 missense probably benign 0.07
IGL02379:Bcr APN 10 75157148 missense probably benign 0.02
IGL02380:Bcr APN 10 75175299 missense probably benign
IGL02385:Bcr APN 10 75145403 missense probably damaging 1.00
IGL02657:Bcr APN 10 75154964 missense probably benign 0.00
IGL02682:Bcr APN 10 75166046 missense possibly damaging 0.67
IGL02959:Bcr APN 10 75160390 missense probably benign 0.44
accrual UTSW 10 75061506 missense possibly damaging 0.77
Appreciation UTSW 10 75061125 nonsense probably null
R0329:Bcr UTSW 10 75181634 missense possibly damaging 0.88
R0330:Bcr UTSW 10 75181634 missense possibly damaging 0.88
R0376:Bcr UTSW 10 75145327 missense probably damaging 1.00
R0685:Bcr UTSW 10 75131643 missense probably damaging 1.00
R0828:Bcr UTSW 10 75157207 unclassified probably benign
R0892:Bcr UTSW 10 75125063 missense probably benign 0.00
R1143:Bcr UTSW 10 75061365 missense probably benign 0.00
R1416:Bcr UTSW 10 75061506 missense possibly damaging 0.77
R1479:Bcr UTSW 10 75061125 nonsense probably null
R1611:Bcr UTSW 10 75125202 splice site probably null
R1636:Bcr UTSW 10 75131066 missense probably damaging 1.00
R1837:Bcr UTSW 10 75168100 splice site probably benign
R2341:Bcr UTSW 10 75131112 missense probably damaging 1.00
R2343:Bcr UTSW 10 75145422 missense probably benign 0.03
R3753:Bcr UTSW 10 75135940 missense probably benign 0.05
R4273:Bcr UTSW 10 75125111 missense probably damaging 0.97
R4624:Bcr UTSW 10 75153920 missense probably damaging 1.00
R4723:Bcr UTSW 10 75175329 missense probably benign 0.45
R5013:Bcr UTSW 10 75125066 missense probably benign 0.00
R5359:Bcr UTSW 10 75166085 missense probably damaging 0.99
R5458:Bcr UTSW 10 75154960 missense probably benign
R5982:Bcr UTSW 10 75176416 missense probably benign 0.08
R5988:Bcr UTSW 10 75175335 missense probably benign 0.01
R6220:Bcr UTSW 10 75062292 missense probably benign
R6827:Bcr UTSW 10 75131064 missense probably damaging 1.00
R6990:Bcr UTSW 10 75131036 missense possibly damaging 0.80
R7003:Bcr UTSW 10 75061561 missense probably benign 0.08
R7424:Bcr UTSW 10 75157100 missense probably benign
R7443:Bcr UTSW 10 75143136 critical splice donor site probably null
R7488:Bcr UTSW 10 75160330 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AAGAGGTCTCTAGGTGGTCTC -3'
(R):5'- CAGTGCTGACTTTGAGCCTG -3'

Sequencing Primer
(F):5'- GTCTCTAGGTGGTCTCCTTGC -3'
(R):5'- GCCTGGCTTCTTATATATACAACGAC -3'
Posted On2018-10-18