Incidental Mutation 'R6886:Vmn2r81'
ID536964
Institutional Source Beutler Lab
Gene Symbol Vmn2r81
Ensembl Gene ENSMUSG00000055515
Gene Namevomeronasal 2, receptor 81
SynonymsV2rf2, EC1-VR2, pheromone recepter
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6886 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79247777-79294535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 79268154 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 204 (S204A)
Ref Sequence ENSEMBL: ENSMUSP00000020547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020547]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020547
AA Change: S204A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020547
Gene: ENSMUSG00000055515
AA Change: S204A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 79 474 7.7e-37 PFAM
Pfam:NCD3G 517 570 8.9e-21 PFAM
Pfam:7tm_3 603 838 6.1e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit vomeronasal sensory neuron axons that spread out diffusely over the posterior accessory olfactory bulb and extend abnormally into the anterior olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,028,690 M44K probably benign Het
Bad T C 19: 6,951,334 probably benign Het
Bbs12 A G 3: 37,319,241 D61G probably damaging Het
Bcr C T 10: 75,153,937 R722C probably damaging Het
Carf C A 1: 60,136,254 probably null Het
Ccdc181 A G 1: 164,280,096 E116G probably damaging Het
Celsr1 A G 15: 86,031,654 V706A probably benign Het
Col9a1 T A 1: 24,185,345 S203T unknown Het
Ctsl T C 13: 64,365,147 probably null Het
Exosc7 A T 9: 123,135,958 E277D probably benign Het
Fam20b A T 1: 156,690,511 W238R probably damaging Het
Fanci A T 7: 79,420,342 H430L possibly damaging Het
Fstl4 A G 11: 53,186,450 D678G probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gm11569 T A 11: 99,798,421 probably benign Het
Gm13084 A G 4: 143,812,762 F54L probably benign Het
Igfn1 G A 1: 135,973,460 R306W probably damaging Het
Il6 C T 5: 30,018,203 probably benign Het
Khdc1c T C 1: 21,369,525 L100P possibly damaging Het
Kif18a G A 2: 109,296,663 R314H probably damaging Het
Kif26b A C 1: 178,874,138 K694T probably damaging Het
Kndc1 A G 7: 139,913,569 T484A probably benign Het
Lonrf1 T C 8: 36,229,037 probably null Het
Man1a2 C T 3: 100,656,071 G169D probably benign Het
Med6 G T 12: 81,591,385 D17E probably damaging Het
Neb T C 2: 52,220,224 K204R probably damaging Het
Nhlrc1 T A 13: 47,013,776 N335I possibly damaging Het
Nlrp12 T C 7: 3,240,683 M400V probably benign Het
Olfr1054 A T 2: 86,333,064 C97* probably null Het
Olfr866 G T 9: 20,027,132 H269N probably benign Het
Pkhd1 C T 1: 20,347,280 S2549N probably benign Het
Rab4b A C 7: 27,172,956 L145R probably damaging Het
Rad50 T C 11: 53,686,184 I526V probably benign Het
Rel T C 11: 23,744,304 H309R probably benign Het
Rnf2 G T 1: 151,473,266 N34K possibly damaging Het
Serpina3m G T 12: 104,389,127 V18F possibly damaging Het
Serpinb9c T C 13: 33,150,327 K244R probably benign Het
Setbp1 T A 18: 78,857,500 Y984F probably damaging Het
Slc12a5 T A 2: 164,982,905 M410K probably benign Het
Smarca4 C T 9: 21,658,831 A710V probably damaging Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Ssrp1 T A 2: 85,039,936 D101E probably benign Het
Tax1bp1 A T 6: 52,733,223 E162D probably benign Het
Tenm4 T A 7: 96,797,392 M823K possibly damaging Het
Tesk1 A G 4: 43,443,592 D53G possibly damaging Het
Tnrc6a T A 7: 123,187,445 S1577T probably benign Het
Tpr A G 1: 150,423,965 I1270V probably benign Het
Trp53bp2 T C 1: 182,429,043 probably null Het
Ube4a A T 9: 44,948,843 I307N probably damaging Het
Unc13b A G 4: 43,170,156 probably benign Het
Vmn2r3 T C 3: 64,259,506 K735E probably damaging Het
Vmn2r54 A G 7: 12,632,153 F285L probably benign Het
Washc1 A G 17: 66,119,066 D453G probably damaging Het
Zfp329 T A 7: 12,810,098 I500L probably benign Het
Zfp516 A G 18: 82,957,000 D441G probably benign Het
Zfp644 T C 5: 106,637,911 T257A possibly damaging Het
Other mutations in Vmn2r81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Vmn2r81 APN 10 79247997 missense probably benign 0.20
IGL02255:Vmn2r81 APN 10 79247972 nonsense probably null
IGL02901:Vmn2r81 APN 10 79270730 missense probably damaging 0.98
R0383:Vmn2r81 UTSW 10 79293447 missense possibly damaging 0.95
R0555:Vmn2r81 UTSW 10 79293449 missense probably damaging 1.00
R0715:Vmn2r81 UTSW 10 79268600 missense probably damaging 1.00
R0967:Vmn2r81 UTSW 10 79248023 splice site probably benign
R1438:Vmn2r81 UTSW 10 79293857 missense probably benign 0.00
R1468:Vmn2r81 UTSW 10 79293662 missense probably damaging 1.00
R1468:Vmn2r81 UTSW 10 79293662 missense probably damaging 1.00
R1589:Vmn2r81 UTSW 10 79293024 missense probably damaging 0.99
R1671:Vmn2r81 UTSW 10 79267431 missense probably benign 0.04
R1672:Vmn2r81 UTSW 10 79268278 missense probably damaging 0.99
R1728:Vmn2r81 UTSW 10 79270655 missense probably benign 0.08
R1784:Vmn2r81 UTSW 10 79270655 missense probably benign 0.08
R1931:Vmn2r81 UTSW 10 79293494 missense probably damaging 0.98
R1934:Vmn2r81 UTSW 10 79247794 start codon destroyed probably null 0.71
R1944:Vmn2r81 UTSW 10 79293737 missense probably damaging 1.00
R2102:Vmn2r81 UTSW 10 79293500 missense probably damaging 0.97
R2190:Vmn2r81 UTSW 10 79268251 missense possibly damaging 0.67
R2392:Vmn2r81 UTSW 10 79274682 missense probably damaging 1.00
R3770:Vmn2r81 UTSW 10 79270600 missense probably damaging 1.00
R4551:Vmn2r81 UTSW 10 79268407 missense possibly damaging 0.95
R4629:Vmn2r81 UTSW 10 79267442 missense probably damaging 0.99
R4691:Vmn2r81 UTSW 10 79293377 nonsense probably null
R4829:Vmn2r81 UTSW 10 79247801 missense possibly damaging 0.48
R4914:Vmn2r81 UTSW 10 79270523 missense probably null 1.00
R4996:Vmn2r81 UTSW 10 79293413 missense probably benign 0.04
R5242:Vmn2r81 UTSW 10 79293475 nonsense probably null
R5253:Vmn2r81 UTSW 10 79247986 missense probably benign 0.00
R5925:Vmn2r81 UTSW 10 79247803 missense probably damaging 1.00
R6169:Vmn2r81 UTSW 10 79268548 missense probably benign
R6270:Vmn2r81 UTSW 10 79293815 missense probably benign
R6525:Vmn2r81 UTSW 10 79293726 missense probably benign 0.11
R6813:Vmn2r81 UTSW 10 79268605 missense probably benign 0.00
R7200:Vmn2r81 UTSW 10 79270736 critical splice donor site probably null
R7350:Vmn2r81 UTSW 10 79268385 missense probably benign 0.03
R7504:Vmn2r81 UTSW 10 79268332 missense probably benign
R7832:Vmn2r81 UTSW 10 79293830 missense probably damaging 1.00
R7915:Vmn2r81 UTSW 10 79293830 missense probably damaging 1.00
X0067:Vmn2r81 UTSW 10 79293043 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GACCTGTTTGCAAAATGAAAGATAC -3'
(R):5'- CTTGTGATATCAAACGAAGTAGGG -3'

Sequencing Primer
(F):5'- ATGAGATCCTGCTGCAATGC -3'
(R):5'- TCAAACGAAGTAGGGTTTCCC -3'
Posted On2018-10-18