Incidental Mutation 'R6886:Serpina3m'
ID536970
Institutional Source Beutler Lab
Gene Symbol Serpina3m
Ensembl Gene ENSMUSG00000079012
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3M
Synonymsantitrypsin, Spi2.4, alpha-1 antiproteinase, MMSPi2.4, contrapsin-like, Spi-2l, Spi-2rs1, 3e46, MMCM7, Spi2-rs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6886 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location104338486-104394257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 104389127 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 18 (V18F)
Ref Sequence ENSEMBL: ENSMUSP00000130979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101078] [ENSMUST00000168797]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101078
AA Change: V18F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098639
Gene: ENSMUSG00000079012
AA Change: V18F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 56 417 3.12e-199 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168797
AA Change: V18F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130979
Gene: ENSMUSG00000079012
AA Change: V18F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 56 417 3.12e-199 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,028,690 M44K probably benign Het
Bad T C 19: 6,951,334 probably benign Het
Bbs12 A G 3: 37,319,241 D61G probably damaging Het
Bcr C T 10: 75,153,937 R722C probably damaging Het
Carf C A 1: 60,136,254 probably null Het
Ccdc181 A G 1: 164,280,096 E116G probably damaging Het
Celsr1 A G 15: 86,031,654 V706A probably benign Het
Col9a1 T A 1: 24,185,345 S203T unknown Het
Ctsl T C 13: 64,365,147 probably null Het
Exosc7 A T 9: 123,135,958 E277D probably benign Het
Fam20b A T 1: 156,690,511 W238R probably damaging Het
Fanci A T 7: 79,420,342 H430L possibly damaging Het
Fstl4 A G 11: 53,186,450 D678G probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gm11569 T A 11: 99,798,421 probably benign Het
Gm13084 A G 4: 143,812,762 F54L probably benign Het
Igfn1 G A 1: 135,973,460 R306W probably damaging Het
Il6 C T 5: 30,018,203 probably benign Het
Khdc1c T C 1: 21,369,525 L100P possibly damaging Het
Kif18a G A 2: 109,296,663 R314H probably damaging Het
Kif26b A C 1: 178,874,138 K694T probably damaging Het
Kndc1 A G 7: 139,913,569 T484A probably benign Het
Lonrf1 T C 8: 36,229,037 probably null Het
Man1a2 C T 3: 100,656,071 G169D probably benign Het
Med6 G T 12: 81,591,385 D17E probably damaging Het
Neb T C 2: 52,220,224 K204R probably damaging Het
Nhlrc1 T A 13: 47,013,776 N335I possibly damaging Het
Nlrp12 T C 7: 3,240,683 M400V probably benign Het
Olfr1054 A T 2: 86,333,064 C97* probably null Het
Olfr866 G T 9: 20,027,132 H269N probably benign Het
Pkhd1 C T 1: 20,347,280 S2549N probably benign Het
Rab4b A C 7: 27,172,956 L145R probably damaging Het
Rad50 T C 11: 53,686,184 I526V probably benign Het
Rel T C 11: 23,744,304 H309R probably benign Het
Rnf2 G T 1: 151,473,266 N34K possibly damaging Het
Serpinb9c T C 13: 33,150,327 K244R probably benign Het
Setbp1 T A 18: 78,857,500 Y984F probably damaging Het
Slc12a5 T A 2: 164,982,905 M410K probably benign Het
Smarca4 C T 9: 21,658,831 A710V probably damaging Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Ssrp1 T A 2: 85,039,936 D101E probably benign Het
Tax1bp1 A T 6: 52,733,223 E162D probably benign Het
Tenm4 T A 7: 96,797,392 M823K possibly damaging Het
Tesk1 A G 4: 43,443,592 D53G possibly damaging Het
Tnrc6a T A 7: 123,187,445 S1577T probably benign Het
Tpr A G 1: 150,423,965 I1270V probably benign Het
Trp53bp2 T C 1: 182,429,043 probably null Het
Ube4a A T 9: 44,948,843 I307N probably damaging Het
Unc13b A G 4: 43,170,156 probably benign Het
Vmn2r3 T C 3: 64,259,506 K735E probably damaging Het
Vmn2r54 A G 7: 12,632,153 F285L probably benign Het
Vmn2r81 T G 10: 79,268,154 S204A possibly damaging Het
Washc1 A G 17: 66,119,066 D453G probably damaging Het
Zfp329 T A 7: 12,810,098 I500L probably benign Het
Zfp516 A G 18: 82,957,000 D441G probably benign Het
Zfp644 T C 5: 106,637,911 T257A possibly damaging Het
Other mutations in Serpina3m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4976:Serpina3m UTSW 12 104358623 intron probably null
R1797:Serpina3m UTSW 12 104389515 missense probably damaging 1.00
R1929:Serpina3m UTSW 12 104389322 missense probably damaging 0.97
R1991:Serpina3m UTSW 12 104389699 nonsense probably null
R2032:Serpina3m UTSW 12 104389669 missense probably benign 0.00
R2094:Serpina3m UTSW 12 104389270 missense probably benign 0.35
R2103:Serpina3m UTSW 12 104389699 nonsense probably null
R2121:Serpina3m UTSW 12 104389682 missense possibly damaging 0.59
R2147:Serpina3m UTSW 12 104389224 missense probably benign 0.01
R2241:Serpina3m UTSW 12 104389449 missense probably benign 0.01
R2330:Serpina3m UTSW 12 104391704 missense possibly damaging 0.61
R4057:Serpina3m UTSW 12 104391737 splice site probably benign
R4275:Serpina3m UTSW 12 104389116 missense probably damaging 0.99
R4466:Serpina3m UTSW 12 104391615 missense probably damaging 1.00
R4901:Serpina3m UTSW 12 104389649 nonsense probably null
R4924:Serpina3m UTSW 12 104391470 missense probably benign 0.00
R4964:Serpina3m UTSW 12 104389101 missense probably benign 0.43
R5723:Serpina3m UTSW 12 104393911 missense probably damaging 0.96
R5836:Serpina3m UTSW 12 104389250 missense probably damaging 1.00
R6172:Serpina3m UTSW 12 104389227 missense probably damaging 1.00
R6619:Serpina3m UTSW 12 104391507 missense probably benign 0.02
R6857:Serpina3m UTSW 12 104389326 missense probably damaging 1.00
R7063:Serpina3m UTSW 12 104391467 missense probably benign 0.00
R7170:Serpina3m UTSW 12 104389518 missense probably damaging 1.00
R7622:Serpina3m UTSW 12 104389575 missense possibly damaging 0.82
Z1177:Serpina3m UTSW 12 104389452 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAGTACTGAATCTGAGAGGCC -3'
(R):5'- CAGCTGAGATGCTAAGTGGG -3'

Sequencing Primer
(F):5'- CCTCCTGTGGACAGTCAAAGAG -3'
(R):5'- GGGGAGAAGACAATATTTTTATCTGG -3'
Posted On2018-10-18