Incidental Mutation 'R6886:Nhlrc1'
ID536972
Institutional Source Beutler Lab
Gene Symbol Nhlrc1
Ensembl Gene ENSMUSG00000044231
Gene NameNHL repeat containing 1
SynonymsMalin, EPM2B, B230309E09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R6886 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location47012557-47014850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47013776 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 335 (N335I)
Ref Sequence ENSEMBL: ENSMUSP00000054990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052747]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052747
AA Change: N335I

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054990
Gene: ENSMUSG00000044231
AA Change: N335I

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RING 28 73 1.45e-6 SMART
low complexity region 89 99 N/A INTRINSIC
low complexity region 101 113 N/A INTRINSIC
internal_repeat_1 128 245 5.99e-5 PROSPERO
internal_repeat_1 263 394 5.99e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single subunit E3 ubiquitin ligase. Laforin is polyubiquitinated by the encoded protein. Defects in this intronless gene lead to an accumulation of laforin and onset of Lafora disease, also known as progressive myoclonic epilepsy type 2 (EPM2).[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of Lafora bodies and total glycogen levels in the heart muscle, skeletal muscle, and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,028,690 M44K probably benign Het
Bad T C 19: 6,951,334 probably benign Het
Bbs12 A G 3: 37,319,241 D61G probably damaging Het
Bcr C T 10: 75,153,937 R722C probably damaging Het
Carf C A 1: 60,136,254 probably null Het
Ccdc181 A G 1: 164,280,096 E116G probably damaging Het
Celsr1 A G 15: 86,031,654 V706A probably benign Het
Col9a1 T A 1: 24,185,345 S203T unknown Het
Ctsl T C 13: 64,365,147 probably null Het
Exosc7 A T 9: 123,135,958 E277D probably benign Het
Fam20b A T 1: 156,690,511 W238R probably damaging Het
Fanci A T 7: 79,420,342 H430L possibly damaging Het
Fstl4 A G 11: 53,186,450 D678G probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gm11569 T A 11: 99,798,421 probably benign Het
Gm13084 A G 4: 143,812,762 F54L probably benign Het
Igfn1 G A 1: 135,973,460 R306W probably damaging Het
Il6 C T 5: 30,018,203 probably benign Het
Khdc1c T C 1: 21,369,525 L100P possibly damaging Het
Kif18a G A 2: 109,296,663 R314H probably damaging Het
Kif26b A C 1: 178,874,138 K694T probably damaging Het
Kndc1 A G 7: 139,913,569 T484A probably benign Het
Lonrf1 T C 8: 36,229,037 probably null Het
Man1a2 C T 3: 100,656,071 G169D probably benign Het
Med6 G T 12: 81,591,385 D17E probably damaging Het
Neb T C 2: 52,220,224 K204R probably damaging Het
Nlrp12 T C 7: 3,240,683 M400V probably benign Het
Olfr1054 A T 2: 86,333,064 C97* probably null Het
Olfr866 G T 9: 20,027,132 H269N probably benign Het
Pkhd1 C T 1: 20,347,280 S2549N probably benign Het
Rab4b A C 7: 27,172,956 L145R probably damaging Het
Rad50 T C 11: 53,686,184 I526V probably benign Het
Rel T C 11: 23,744,304 H309R probably benign Het
Rnf2 G T 1: 151,473,266 N34K possibly damaging Het
Serpina3m G T 12: 104,389,127 V18F possibly damaging Het
Serpinb9c T C 13: 33,150,327 K244R probably benign Het
Setbp1 T A 18: 78,857,500 Y984F probably damaging Het
Slc12a5 T A 2: 164,982,905 M410K probably benign Het
Smarca4 C T 9: 21,658,831 A710V probably damaging Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Ssrp1 T A 2: 85,039,936 D101E probably benign Het
Tax1bp1 A T 6: 52,733,223 E162D probably benign Het
Tenm4 T A 7: 96,797,392 M823K possibly damaging Het
Tesk1 A G 4: 43,443,592 D53G possibly damaging Het
Tnrc6a T A 7: 123,187,445 S1577T probably benign Het
Tpr A G 1: 150,423,965 I1270V probably benign Het
Trp53bp2 T C 1: 182,429,043 probably null Het
Ube4a A T 9: 44,948,843 I307N probably damaging Het
Unc13b A G 4: 43,170,156 probably benign Het
Vmn2r3 T C 3: 64,259,506 K735E probably damaging Het
Vmn2r54 A G 7: 12,632,153 F285L probably benign Het
Vmn2r81 T G 10: 79,268,154 S204A possibly damaging Het
Washc1 A G 17: 66,119,066 D453G probably damaging Het
Zfp329 T A 7: 12,810,098 I500L probably benign Het
Zfp516 A G 18: 82,957,000 D441G probably benign Het
Zfp644 T C 5: 106,637,911 T257A possibly damaging Het
Other mutations in Nhlrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Nhlrc1 APN 13 47014131 missense probably damaging 0.97
IGL01759:Nhlrc1 APN 13 47013962 missense probably benign 0.00
R1540:Nhlrc1 UTSW 13 47014344 missense probably damaging 1.00
R2116:Nhlrc1 UTSW 13 47014185 missense probably benign 0.00
R4243:Nhlrc1 UTSW 13 47014026 missense probably benign 0.06
R4563:Nhlrc1 UTSW 13 47014190 missense possibly damaging 0.67
R4975:Nhlrc1 UTSW 13 47013740 missense probably benign 0.28
R5100:Nhlrc1 UTSW 13 47014421 missense probably benign
R5671:Nhlrc1 UTSW 13 47013717 missense probably benign 0.06
R5770:Nhlrc1 UTSW 13 47014712 missense probably benign 0.22
R6476:Nhlrc1 UTSW 13 47014181 missense possibly damaging 0.95
R7223:Nhlrc1 UTSW 13 47014208 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AAGATTTCTGACTCCTGGCTTCAG -3'
(R):5'- GTCCTAGAGCATCCTTGTGC -3'

Sequencing Primer
(F):5'- GGCTTCAGGATCCCCATCAC -3'
(R):5'- AGAGCATCCTTGTGCCTTTG -3'
Posted On2018-10-18