Incidental Mutation 'R6886:Washc1'
ID536975
Institutional Source Beutler Lab
Gene Symbol Washc1
Ensembl Gene ENSMUSG00000024101
Gene NameWASH complex subunit 1
SynonymsORF19, 1110049F14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6886 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location66111546-66120503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66119066 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 453 (D453G)
Ref Sequence ENSEMBL: ENSMUSP00000112255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072383] [ENSMUST00000116556] [ENSMUST00000163605] [ENSMUST00000224497] [ENSMUST00000224903] [ENSMUST00000225956]
Predicted Effect probably damaging
Transcript: ENSMUST00000072383
AA Change: D453G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072220
Gene: ENSMUSG00000024101
AA Change: D453G

DomainStartEndE-ValueType
Pfam:WASH_WAHD 11 304 6.1e-142 PFAM
low complexity region 387 408 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
low complexity region 456 464 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116556
AA Change: D453G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112255
Gene: ENSMUSG00000024101
AA Change: D453G

DomainStartEndE-ValueType
Pfam:WASH_WAHD 12 299 3e-129 PFAM
low complexity region 302 318 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
low complexity region 456 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163605
SMART Domains Protein: ENSMUSP00000130440
Gene: ENSMUSG00000035842

DomainStartEndE-ValueType
DEXDc 11 408 1.14e-153 SMART
Blast:DEXDc2 430 479 6e-14 BLAST
HELICc 682 839 1.4e-66 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224497
Predicted Effect probably benign
Transcript: ENSMUST00000224903
Predicted Effect probably benign
Transcript: ENSMUST00000225956
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality prior to E7.5 with increased cell death and autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,028,690 M44K probably benign Het
Bad T C 19: 6,951,334 probably benign Het
Bbs12 A G 3: 37,319,241 D61G probably damaging Het
Bcr C T 10: 75,153,937 R722C probably damaging Het
Carf C A 1: 60,136,254 probably null Het
Ccdc181 A G 1: 164,280,096 E116G probably damaging Het
Celsr1 A G 15: 86,031,654 V706A probably benign Het
Col9a1 T A 1: 24,185,345 S203T unknown Het
Ctsl T C 13: 64,365,147 probably null Het
Exosc7 A T 9: 123,135,958 E277D probably benign Het
Fam20b A T 1: 156,690,511 W238R probably damaging Het
Fanci A T 7: 79,420,342 H430L possibly damaging Het
Fstl4 A G 11: 53,186,450 D678G probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gm11569 T A 11: 99,798,421 probably benign Het
Gm13084 A G 4: 143,812,762 F54L probably benign Het
Igfn1 G A 1: 135,973,460 R306W probably damaging Het
Il6 C T 5: 30,018,203 probably benign Het
Khdc1c T C 1: 21,369,525 L100P possibly damaging Het
Kif18a G A 2: 109,296,663 R314H probably damaging Het
Kif26b A C 1: 178,874,138 K694T probably damaging Het
Kndc1 A G 7: 139,913,569 T484A probably benign Het
Lonrf1 T C 8: 36,229,037 probably null Het
Man1a2 C T 3: 100,656,071 G169D probably benign Het
Med6 G T 12: 81,591,385 D17E probably damaging Het
Neb T C 2: 52,220,224 K204R probably damaging Het
Nhlrc1 T A 13: 47,013,776 N335I possibly damaging Het
Nlrp12 T C 7: 3,240,683 M400V probably benign Het
Olfr1054 A T 2: 86,333,064 C97* probably null Het
Olfr866 G T 9: 20,027,132 H269N probably benign Het
Pkhd1 C T 1: 20,347,280 S2549N probably benign Het
Rab4b A C 7: 27,172,956 L145R probably damaging Het
Rad50 T C 11: 53,686,184 I526V probably benign Het
Rel T C 11: 23,744,304 H309R probably benign Het
Rnf2 G T 1: 151,473,266 N34K possibly damaging Het
Serpina3m G T 12: 104,389,127 V18F possibly damaging Het
Serpinb9c T C 13: 33,150,327 K244R probably benign Het
Setbp1 T A 18: 78,857,500 Y984F probably damaging Het
Slc12a5 T A 2: 164,982,905 M410K probably benign Het
Smarca4 C T 9: 21,658,831 A710V probably damaging Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Ssrp1 T A 2: 85,039,936 D101E probably benign Het
Tax1bp1 A T 6: 52,733,223 E162D probably benign Het
Tenm4 T A 7: 96,797,392 M823K possibly damaging Het
Tesk1 A G 4: 43,443,592 D53G possibly damaging Het
Tnrc6a T A 7: 123,187,445 S1577T probably benign Het
Tpr A G 1: 150,423,965 I1270V probably benign Het
Trp53bp2 T C 1: 182,429,043 probably null Het
Ube4a A T 9: 44,948,843 I307N probably damaging Het
Unc13b A G 4: 43,170,156 probably benign Het
Vmn2r3 T C 3: 64,259,506 K735E probably damaging Het
Vmn2r54 A G 7: 12,632,153 F285L probably benign Het
Vmn2r81 T G 10: 79,268,154 S204A possibly damaging Het
Zfp329 T A 7: 12,810,098 I500L probably benign Het
Zfp516 A G 18: 82,957,000 D441G probably benign Het
Zfp644 T C 5: 106,637,911 T257A possibly damaging Het
Other mutations in Washc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0271:Washc1 UTSW 17 66116719 missense possibly damaging 0.82
R3420:Washc1 UTSW 17 66117033 missense probably damaging 0.96
R3941:Washc1 UTSW 17 66118128 missense probably damaging 0.99
R4078:Washc1 UTSW 17 66117161 missense probably benign 0.05
R4524:Washc1 UTSW 17 66119092 nonsense probably null
R5481:Washc1 UTSW 17 66118865 missense probably benign 0.00
R5769:Washc1 UTSW 17 66118116 missense probably benign 0.01
R7803:Washc1 UTSW 17 66119060 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TTACCTATTATCCATCTTCAGGGGC -3'
(R):5'- ACAGTCCCGACTCCATGAAG -3'

Sequencing Primer
(F):5'- GCTGGTGAAGTAGTACCTCAC -3'
(R):5'- TCCCGACTCCATGAAGAGGAATTAG -3'
Posted On2018-10-18