Incidental Mutation 'R6887:Mrc1'
ID536979
Institutional Source Beutler Lab
Gene Symbol Mrc1
Ensembl Gene ENSMUSG00000026712
Gene Namemannose receptor, C type 1
SynonymsCD206, MR
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_008625.2; MGI:97142

Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location14229392-14332057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14325237 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1219 (A1219V)
Ref Sequence ENSEMBL: ENSMUSP00000028045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028045]
PDB Structure
CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028045
AA Change: A1219V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: A1219V

DomainStartEndE-ValueType
RICIN 22 142 8.09e-18 SMART
FN2 161 209 1.83e-27 SMART
CLECT 216 341 8.87e-26 SMART
CLECT 362 487 3.51e-38 SMART
CLECT 504 626 8.2e-30 SMART
CLECT 646 778 2.34e-34 SMART
CLECT 800 923 2.17e-29 SMART
low complexity region 935 941 N/A INTRINSIC
CLECT 944 1079 3.35e-35 SMART
CLECT 1094 1212 4.11e-21 SMART
CLECT 1229 1355 3.63e-31 SMART
transmembrane domain 1388 1410 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype Strain: 2656742; 2448258
Lethality: E1-E7
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Mrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Mrc1 APN 2 14328425 missense probably damaging 1.00
IGL01326:Mrc1 APN 2 14266524 missense probably damaging 1.00
IGL01340:Mrc1 APN 2 14310084 critical splice donor site probably null
IGL01758:Mrc1 APN 2 14238248 missense probably damaging 1.00
IGL01799:Mrc1 APN 2 14238376 missense probably damaging 1.00
IGL02280:Mrc1 APN 2 14244213 missense probably benign 0.19
IGL02435:Mrc1 APN 2 14248860 nonsense probably null
IGL03073:Mrc1 APN 2 14305342 missense probably damaging 1.00
IGL03110:Mrc1 APN 2 14293478 nonsense probably null
IGL03155:Mrc1 APN 2 14331101 missense probably benign 0.00
IGL03289:Mrc1 APN 2 14308823 critical splice donor site probably null
Shug UTSW 2 14270206 missense probably damaging 1.00
sussigkeit UTSW 2 14325381 splice site probably null
R0011:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R0011:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R0066:Mrc1 UTSW 2 14261200 missense probably benign 0.42
R0066:Mrc1 UTSW 2 14261200 missense probably benign 0.42
R0110:Mrc1 UTSW 2 14238542 splice site probably benign
R0234:Mrc1 UTSW 2 14279894 missense possibly damaging 0.65
R0234:Mrc1 UTSW 2 14279894 missense possibly damaging 0.65
R0381:Mrc1 UTSW 2 14307909 missense probably benign 0.05
R0505:Mrc1 UTSW 2 14310032 missense probably damaging 1.00
R0539:Mrc1 UTSW 2 14270126 splice site probably benign
R0613:Mrc1 UTSW 2 14294819 missense probably damaging 0.96
R0626:Mrc1 UTSW 2 14328571 nonsense probably null
R1122:Mrc1 UTSW 2 14261336 critical splice donor site probably null
R1281:Mrc1 UTSW 2 14293510 missense probably damaging 1.00
R1399:Mrc1 UTSW 2 14279925 missense probably damaging 1.00
R1428:Mrc1 UTSW 2 14315263 missense probably benign 0.11
R1571:Mrc1 UTSW 2 14308733 missense probably damaging 0.97
R1596:Mrc1 UTSW 2 14248890 missense possibly damaging 0.91
R1730:Mrc1 UTSW 2 14327844 missense probably benign 0.01
R1733:Mrc1 UTSW 2 14257099 missense probably damaging 1.00
R1783:Mrc1 UTSW 2 14327844 missense probably benign 0.01
R1860:Mrc1 UTSW 2 14328579 missense probably benign 0.30
R1872:Mrc1 UTSW 2 14325381 splice site probably null
R1889:Mrc1 UTSW 2 14308677 critical splice acceptor site probably null
R1938:Mrc1 UTSW 2 14319241 missense possibly damaging 0.89
R1971:Mrc1 UTSW 2 14244292 critical splice donor site probably null
R2031:Mrc1 UTSW 2 14321773 missense probably damaging 1.00
R2136:Mrc1 UTSW 2 14270189 missense probably damaging 1.00
R2152:Mrc1 UTSW 2 14327864 missense probably damaging 1.00
R2168:Mrc1 UTSW 2 14244204 missense possibly damaging 0.90
R2273:Mrc1 UTSW 2 14325372 missense probably damaging 1.00
R2901:Mrc1 UTSW 2 14328543 missense possibly damaging 0.94
R3767:Mrc1 UTSW 2 14319170 missense probably damaging 1.00
R3795:Mrc1 UTSW 2 14288982 splice site probably benign
R4028:Mrc1 UTSW 2 14238248 missense probably damaging 1.00
R4668:Mrc1 UTSW 2 14293486 missense probably damaging 1.00
R4828:Mrc1 UTSW 2 14270206 missense probably damaging 1.00
R4897:Mrc1 UTSW 2 14319141 missense probably benign 0.01
R4950:Mrc1 UTSW 2 14271280 missense probably damaging 1.00
R5000:Mrc1 UTSW 2 14244189 missense probably damaging 1.00
R5068:Mrc1 UTSW 2 14306516 missense probably benign 0.00
R5279:Mrc1 UTSW 2 14310058 missense probably damaging 0.99
R5366:Mrc1 UTSW 2 14321914 missense probably benign 0.03
R5436:Mrc1 UTSW 2 14266515 missense probably damaging 1.00
R5552:Mrc1 UTSW 2 14279957 missense probably benign 0.05
R5631:Mrc1 UTSW 2 14328572 nonsense probably null
R5831:Mrc1 UTSW 2 14308712 missense probably damaging 0.99
R5978:Mrc1 UTSW 2 14315393 missense probably damaging 0.97
R5993:Mrc1 UTSW 2 14305327 missense probably damaging 1.00
R6030:Mrc1 UTSW 2 14316901 missense probably benign 0.04
R6030:Mrc1 UTSW 2 14316901 missense probably benign 0.04
R6038:Mrc1 UTSW 2 14257071 missense probably damaging 1.00
R6038:Mrc1 UTSW 2 14257071 missense probably damaging 1.00
R6228:Mrc1 UTSW 2 14271304 missense probably benign 0.08
R6344:Mrc1 UTSW 2 14244174 missense probably damaging 1.00
R6457:Mrc1 UTSW 2 14270205 missense probably damaging 1.00
R6520:Mrc1 UTSW 2 14307949 missense probably damaging 1.00
R6619:Mrc1 UTSW 2 14294786 splice site probably null
R6631:Mrc1 UTSW 2 14238485 missense probably benign
R6737:Mrc1 UTSW 2 14271277 missense possibly damaging 0.95
R6782:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R7108:Mrc1 UTSW 2 14304146 nonsense probably null
R7120:Mrc1 UTSW 2 14308697 missense probably damaging 0.97
R7460:Mrc1 UTSW 2 14248869 missense probably damaging 1.00
R7567:Mrc1 UTSW 2 14325293 missense probably damaging 1.00
R7606:Mrc1 UTSW 2 14238144 missense probably damaging 1.00
R7725:Mrc1 UTSW 2 14279977 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAAACAGTAAAGTAAGTGAAAACCC -3'
(R):5'- AGAAAGCCACTTAGATCCCTTAC -3'

Sequencing Primer
(F):5'- CCAAGAAAAATGGTGGCCC -3'
(R):5'- TGACCCCAACTTCTCGTA -3'
Posted On2018-10-18