Mutagenetix > Incidental Mutation

Incidental Mutation 'R6887:Mrc1'

536979

Institutional Source

Beutler Lab

Gene Symbol

Mrc1

Ensembl Gene

ENSMUSG00000026712

Gene Name

mannose receptor, C type 1

Synonyms

CD206, MR

MMRRC Submission

044981-MU

Accession Numbers

Ncbi RefSeq: NM_008625.2; MGI:97142

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R6887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14229392-14332057 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 14325237 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1219 (A1219V)

Ref Sequence

ENSEMBL: ENSMUSP00000028045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028045]

AlphaFold

Q61830

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028045
AA Change: A1219V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: A1219V

Domain	Start	End	E-Value	Type
RICIN	22	142	8.09e-18	SMART
FN2	161	209	1.83e-27	SMART
CLECT	216	341	8.87e-26	SMART
CLECT	362	487	3.51e-38	SMART
CLECT	504	626	8.2e-30	SMART
CLECT	646	778	2.34e-34	SMART
CLECT	800	923	2.17e-29	SMART
low complexity region	935	941	N/A	INTRINSIC
CLECT	944	1079	3.35e-35	SMART
CLECT	1094	1212	4.11e-21	SMART
CLECT	1229	1355	3.63e-31	SMART
transmembrane domain	1388	1410	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (39/39)

MGI Phenotype

Strain: 2656742; 2448258
Lethality: E1-E7
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	G	A	7: 79,092,483	V543I	probably damaging	Het
Adcy5	A	G	16: 35,298,590	I1104V	possibly damaging	Het
Adgrl4	A	T	3: 151,542,733	I681F	possibly damaging	Het
Adgrv1	T	A	13: 81,528,701	M2004L	probably benign	Het
Anapc1	A	G	2: 128,659,768	S785P	possibly damaging	Het
Ap3d1	A	T	10: 80,723,698	I242N	probably damaging	Het
Arhgap5	T	C	12: 52,519,144	L966P	probably benign	Het
Atp8a1	T	C	5: 67,738,451	T547A	probably benign	Het
Cadps	A	G	14: 12,505,811	F753S	probably damaging	Het
Cdc20b	T	C	13: 113,078,653	S252P	possibly damaging	Het
Cep63	A	G	9: 102,625,927		probably benign	Het
Chrna5	G	T	9: 55,005,133	V302L	probably benign	Het
Crtc2	A	G	3: 90,261,071	T374A	probably damaging	Het
Dmtf1	T	G	5: 9,137,149	D140A	probably damaging	Het
Exosc8	C	T	3: 54,733,699	V39M	probably damaging	Het
Fam135b	A	C	15: 71,463,315	S677A	probably damaging	Het
Hif1an	T	C	19: 44,563,389	Y93H	probably damaging	Het
Hrc	T	C	7: 45,335,664	F80L	probably benign	Het
Jmjd1c	A	G	10: 67,189,820	T139A	possibly damaging	Het
Kdr	T	G	5: 75,968,451	R178S	probably benign	Het
Lrrc61	A	C	6: 48,568,432	N63T	probably damaging	Het
Neto1	T	C	18: 86,498,635	V359A	probably benign	Het
Ngly1	T	C	14: 16,281,836	I364T	probably benign	Het
Nisch	C	T	14: 31,185,344		probably benign	Het
Olfr1373	C	A	11: 52,145,352	M59I	probably benign	Het
Prrc2a	T	C	17: 35,155,675	D1333G	probably damaging	Het
Raly	G	T	2: 154,861,910	V134F	probably damaging	Het
Rbm6	T	C	9: 107,852,231	Y406C	probably damaging	Het
Robo4	G	C	9: 37,402,067	E6Q	possibly damaging	Het
Scnn1g	C	A	7: 121,760,444	S383R	probably benign	Het
Sgtb	T	C	13: 104,111,151	W13R	probably benign	Het
Slit3	T	C	11: 35,544,806		probably null	Het
Tbc1d32	G	A	10: 56,151,811	Q732*	probably null	Het
Tek	T	A	4: 94,804,944	C247S	probably damaging	Het
Tmf1	A	T	6: 97,176,838	D91E	probably damaging	Het
Usp39	A	G	6: 72,333,157	L326P	probably damaging	Het
Vmn2r7	A	T	3: 64,690,827	C770S	probably damaging	Het
Wdr31	C	T	4: 62,457,565	G58R	probably benign	Het
Zfyve26	A	G	12: 79,266,449	I54T	probably damaging	Het

Other mutations in Mrc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Mrc1	APN	2	14328425	missense	probably damaging	1.00
IGL01326:Mrc1	APN	2	14266524	missense	probably damaging	1.00
IGL01340:Mrc1	APN	2	14310084	critical splice donor site	probably null
IGL01758:Mrc1	APN	2	14238248	missense	probably damaging	1.00
IGL01799:Mrc1	APN	2	14238376	missense	probably damaging	1.00
IGL02280:Mrc1	APN	2	14244213	missense	probably benign	0.19
IGL02435:Mrc1	APN	2	14248860	nonsense	probably null
IGL03073:Mrc1	APN	2	14305342	missense	probably damaging	1.00
IGL03110:Mrc1	APN	2	14293478	nonsense	probably null
IGL03155:Mrc1	APN	2	14331101	missense	probably benign	0.00
IGL03289:Mrc1	APN	2	14308823	critical splice donor site	probably null
amlodipine	UTSW	2	14270205	missense	probably damaging	1.00
losartan	UTSW	2	14294786	splice site	probably null
Shug	UTSW	2	14270206	missense	probably damaging	1.00
sussigkeit	UTSW	2	14325381	splice site	probably null
R0011:Mrc1	UTSW	2	14261337	critical splice donor site	probably null
R0011:Mrc1	UTSW	2	14261337	critical splice donor site	probably null
R0066:Mrc1	UTSW	2	14261200	missense	probably benign	0.42
R0066:Mrc1	UTSW	2	14261200	missense	probably benign	0.42
R0110:Mrc1	UTSW	2	14238542	splice site	probably benign
R0234:Mrc1	UTSW	2	14279894	missense	possibly damaging	0.65
R0234:Mrc1	UTSW	2	14279894	missense	possibly damaging	0.65
R0381:Mrc1	UTSW	2	14307909	missense	probably benign	0.05
R0505:Mrc1	UTSW	2	14310032	missense	probably damaging	1.00
R0539:Mrc1	UTSW	2	14270126	splice site	probably benign
R0613:Mrc1	UTSW	2	14294819	missense	probably damaging	0.96
R0626:Mrc1	UTSW	2	14328571	nonsense	probably null
R1122:Mrc1	UTSW	2	14261336	critical splice donor site	probably null
R1281:Mrc1	UTSW	2	14293510	missense	probably damaging	1.00
R1399:Mrc1	UTSW	2	14279925	missense	probably damaging	1.00
R1428:Mrc1	UTSW	2	14315263	missense	probably benign	0.11
R1571:Mrc1	UTSW	2	14308733	missense	probably damaging	0.97
R1596:Mrc1	UTSW	2	14248890	missense	possibly damaging	0.91
R1730:Mrc1	UTSW	2	14327844	missense	probably benign	0.01
R1733:Mrc1	UTSW	2	14257099	missense	probably damaging	1.00
R1783:Mrc1	UTSW	2	14327844	missense	probably benign	0.01
R1860:Mrc1	UTSW	2	14328579	missense	probably benign	0.30
R1872:Mrc1	UTSW	2	14325381	splice site	probably null
R1889:Mrc1	UTSW	2	14308677	critical splice acceptor site	probably null
R1938:Mrc1	UTSW	2	14319241	missense	possibly damaging	0.89
R1971:Mrc1	UTSW	2	14244292	critical splice donor site	probably null
R2031:Mrc1	UTSW	2	14321773	missense	probably damaging	1.00
R2136:Mrc1	UTSW	2	14270189	missense	probably damaging	1.00
R2152:Mrc1	UTSW	2	14327864	missense	probably damaging	1.00
R2168:Mrc1	UTSW	2	14244204	missense	possibly damaging	0.90
R2273:Mrc1	UTSW	2	14325372	missense	probably damaging	1.00
R2901:Mrc1	UTSW	2	14328543	missense	possibly damaging	0.94
R3767:Mrc1	UTSW	2	14319170	missense	probably damaging	1.00
R3795:Mrc1	UTSW	2	14288982	splice site	probably benign
R4028:Mrc1	UTSW	2	14238248	missense	probably damaging	1.00
R4668:Mrc1	UTSW	2	14293486	missense	probably damaging	1.00
R4828:Mrc1	UTSW	2	14270206	missense	probably damaging	1.00
R4897:Mrc1	UTSW	2	14319141	missense	probably benign	0.01
R4950:Mrc1	UTSW	2	14271280	missense	probably damaging	1.00
R5000:Mrc1	UTSW	2	14244189	missense	probably damaging	1.00
R5068:Mrc1	UTSW	2	14306516	missense	probably benign	0.00
R5279:Mrc1	UTSW	2	14310058	missense	probably damaging	0.99
R5366:Mrc1	UTSW	2	14321914	missense	probably benign	0.03
R5436:Mrc1	UTSW	2	14266515	missense	probably damaging	1.00
R5552:Mrc1	UTSW	2	14279957	missense	probably benign	0.05
R5631:Mrc1	UTSW	2	14328572	nonsense	probably null
R5831:Mrc1	UTSW	2	14308712	missense	probably damaging	0.99
R5978:Mrc1	UTSW	2	14315393	missense	probably damaging	0.97
R5993:Mrc1	UTSW	2	14305327	missense	probably damaging	1.00
R6030:Mrc1	UTSW	2	14316901	missense	probably benign	0.04
R6030:Mrc1	UTSW	2	14316901	missense	probably benign	0.04
R6038:Mrc1	UTSW	2	14257071	missense	probably damaging	1.00
R6038:Mrc1	UTSW	2	14257071	missense	probably damaging	1.00
R6228:Mrc1	UTSW	2	14271304	missense	probably benign	0.08
R6344:Mrc1	UTSW	2	14244174	missense	probably damaging	1.00
R6457:Mrc1	UTSW	2	14270205	missense	probably damaging	1.00
R6520:Mrc1	UTSW	2	14307949	missense	probably damaging	1.00
R6619:Mrc1	UTSW	2	14294786	splice site	probably null
R6631:Mrc1	UTSW	2	14238485	missense	probably benign
R6737:Mrc1	UTSW	2	14271277	missense	possibly damaging	0.95
R6782:Mrc1	UTSW	2	14261337	critical splice donor site	probably null
R7108:Mrc1	UTSW	2	14304146	nonsense	probably null
R7120:Mrc1	UTSW	2	14308697	missense	probably damaging	0.97
R7460:Mrc1	UTSW	2	14248869	missense	probably damaging	1.00
R7567:Mrc1	UTSW	2	14325293	missense	probably damaging	1.00
R7606:Mrc1	UTSW	2	14238144	missense	probably damaging	1.00
R7725:Mrc1	UTSW	2	14279977	missense	probably benign	0.03
R7826:Mrc1	UTSW	2	14294857	missense	probably damaging	1.00
R8082:Mrc1	UTSW	2	14248960	missense	probably benign
R8279:Mrc1	UTSW	2	14266357	missense	possibly damaging	0.89
R8888:Mrc1	UTSW	2	14307949	missense	probably damaging	1.00
R8895:Mrc1	UTSW	2	14307949	missense	probably damaging	1.00
R8952:Mrc1	UTSW	2	14248924	missense	probably damaging	0.98
R9315:Mrc1	UTSW	2	14244158	nonsense	probably null
R9366:Mrc1	UTSW	2	14316898	missense	probably damaging	0.99
R9373:Mrc1	UTSW	2	14270188	missense	probably damaging	0.99
R9418:Mrc1	UTSW	2	14229547	missense	probably benign	0.12
R9420:Mrc1	UTSW	2	14307979	missense	possibly damaging	0.53
R9489:Mrc1	UTSW	2	14319299	missense	probably benign	0.06
R9564:Mrc1	UTSW	2	14261306	missense	probably benign	0.00
R9572:Mrc1	UTSW	2	14229523	missense	probably benign
R9605:Mrc1	UTSW	2	14319299	missense	probably benign	0.06
R9606:Mrc1	UTSW	2	14308706	missense	probably benign	0.01
R9781:Mrc1	UTSW	2	14244289	missense	probably benign
R9781:Mrc1	UTSW	2	14305364	missense	possibly damaging	0.90
Z1177:Mrc1	UTSW	2	14244138	missense	probably damaging	1.00
Z1177:Mrc1	UTSW	2	14289116	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAACAGTAAAGTAAGTGAAAACCC -3'
(R):5'- AGAAAGCCACTTAGATCCCTTAC -3'

Sequencing Primer
(F):5'- CCAAGAAAAATGGTGGCCC -3'
(R):5'- TGACCCCAACTTCTCGTA -3'

Posted On

2018-10-18