Mutagenetix > Incidental Mutation

Incidental Mutation 'R6887:Anapc1'

536980

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

2610021O03Rik, tsg24, Apc1, Mcpr

MMRRC Submission

044981-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128610104-128687391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128659768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 785 (S785P)

Ref Sequence

ENSEMBL: ENSMUSP00000014499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]

AlphaFold

P53995

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014499
AA Change: S785P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: S785P

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110333
AA Change: S785P

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: S785P

Domain	Start	End	E-Value	Type
Pfam:Apc1	149	227	1.7e-22	PFAM
low complexity region	323	345	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	G	A	7: 79,092,483 (GRCm38)	V543I	probably damaging	Het
Adcy5	A	G	16: 35,298,590 (GRCm38)	I1104V	possibly damaging	Het
Adgrl4	A	T	3: 151,542,733 (GRCm38)	I681F	possibly damaging	Het
Adgrv1	T	A	13: 81,528,701 (GRCm38)	M2004L	probably benign	Het
Ap3d1	A	T	10: 80,723,698 (GRCm38)	I242N	probably damaging	Het
Arhgap5	T	C	12: 52,519,144 (GRCm38)	L966P	probably benign	Het
Atp8a1	T	C	5: 67,738,451 (GRCm38)	T547A	probably benign	Het
Cadps	A	G	14: 12,505,811 (GRCm38)	F753S	probably damaging	Het
Cdc20b	T	C	13: 113,078,653 (GRCm38)	S252P	possibly damaging	Het
Cep63	A	G	9: 102,625,927 (GRCm38)		probably benign	Het
Chrna5	G	T	9: 55,005,133 (GRCm38)	V302L	probably benign	Het
Crtc2	A	G	3: 90,261,071 (GRCm38)	T374A	probably damaging	Het
Dmtf1	T	G	5: 9,137,149 (GRCm38)	D140A	probably damaging	Het
Exosc8	C	T	3: 54,733,699 (GRCm38)	V39M	probably damaging	Het
Fam135b	A	C	15: 71,463,315 (GRCm38)	S677A	probably damaging	Het
Hif1an	T	C	19: 44,563,389 (GRCm38)	Y93H	probably damaging	Het
Hrc	T	C	7: 45,335,664 (GRCm38)	F80L	probably benign	Het
Jmjd1c	A	G	10: 67,189,820 (GRCm38)	T139A	possibly damaging	Het
Kdr	T	G	5: 75,968,451 (GRCm38)	R178S	probably benign	Het
Lrrc61	A	C	6: 48,568,432 (GRCm38)	N63T	probably damaging	Het
Mrc1	C	T	2: 14,325,237 (GRCm38)	A1219V	possibly damaging	Het
Neto1	T	C	18: 86,498,635 (GRCm38)	V359A	probably benign	Het
Ngly1	T	C	14: 16,281,836 (GRCm38)	I364T	probably benign	Het
Nisch	C	T	14: 31,185,344 (GRCm38)		probably benign	Het
Olfr1373	C	A	11: 52,145,352 (GRCm38)	M59I	probably benign	Het
Prrc2a	T	C	17: 35,155,675 (GRCm38)	D1333G	probably damaging	Het
Raly	G	T	2: 154,861,910 (GRCm38)	V134F	probably damaging	Het
Rbm6	T	C	9: 107,852,231 (GRCm38)	Y406C	probably damaging	Het
Robo4	G	C	9: 37,402,067 (GRCm38)	E6Q	possibly damaging	Het
Scnn1g	C	A	7: 121,760,444 (GRCm38)	S383R	probably benign	Het
Sgtb	T	C	13: 104,111,151 (GRCm38)	W13R	probably benign	Het
Slit3	T	C	11: 35,544,806 (GRCm38)		probably null	Het
Tbc1d32	G	A	10: 56,151,811 (GRCm38)	Q732*	probably null	Het
Tek	T	A	4: 94,804,944 (GRCm38)	C247S	probably damaging	Het
Tmf1	A	T	6: 97,176,838 (GRCm38)	D91E	probably damaging	Het
Usp39	A	G	6: 72,333,157 (GRCm38)	L326P	probably damaging	Het
Vmn2r7	A	T	3: 64,690,827 (GRCm38)	C770S	probably damaging	Het
Wdr31	C	T	4: 62,457,565 (GRCm38)	G58R	probably benign	Het
Zfyve26	A	G	12: 79,266,449 (GRCm38)	I54T	probably damaging	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128,645,130 (GRCm38)	splice site	probably benign
IGL00704:Anapc1	APN	2	128,663,984 (GRCm38)	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128,629,729 (GRCm38)	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128,633,408 (GRCm38)	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128,653,170 (GRCm38)	missense	probably benign
IGL02089:Anapc1	APN	2	128,663,933 (GRCm38)	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128,659,852 (GRCm38)	missense	probably benign
IGL02570:Anapc1	APN	2	128,645,200 (GRCm38)	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128,623,931 (GRCm38)	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128,659,785 (GRCm38)	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128,627,197 (GRCm38)	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128,627,113 (GRCm38)	splice site	probably benign
IGL03327:Anapc1	APN	2	128,623,934 (GRCm38)	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128,678,218 (GRCm38)	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128,641,511 (GRCm38)	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128,641,511 (GRCm38)	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128,623,966 (GRCm38)	splice site	probably benign
R0103:Anapc1	UTSW	2	128,680,452 (GRCm38)	splice site	probably benign
R0103:Anapc1	UTSW	2	128,680,452 (GRCm38)	splice site	probably benign
R0109:Anapc1	UTSW	2	128,634,693 (GRCm38)	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128,634,693 (GRCm38)	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128,628,629 (GRCm38)	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128,628,629 (GRCm38)	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128,634,711 (GRCm38)	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128,641,340 (GRCm38)	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128,669,043 (GRCm38)	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128,632,655 (GRCm38)	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128,619,332 (GRCm38)	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128,617,731 (GRCm38)	missense	probably benign
R1175:Anapc1	UTSW	2	128,680,188 (GRCm38)	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128,617,697 (GRCm38)	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128,617,556 (GRCm38)	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128,624,899 (GRCm38)	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128,617,716 (GRCm38)	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128,628,532 (GRCm38)	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128,658,246 (GRCm38)	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128,676,208 (GRCm38)	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128,675,890 (GRCm38)	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128,659,788 (GRCm38)	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128,633,415 (GRCm38)	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128,669,688 (GRCm38)	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128,648,458 (GRCm38)	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128,642,548 (GRCm38)	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128,680,137 (GRCm38)	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128,642,682 (GRCm38)	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128,642,519 (GRCm38)	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128,627,229 (GRCm38)	intron	probably benign
R4359:Anapc1	UTSW	2	128,623,556 (GRCm38)	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128,676,249 (GRCm38)	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128,627,195 (GRCm38)	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128,664,005 (GRCm38)	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128,686,060 (GRCm38)	splice site	probably benign
R4824:Anapc1	UTSW	2	128,628,690 (GRCm38)	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128,684,594 (GRCm38)	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128,607,175 (GRCm38)	unclassified	probably benign
R5063:Anapc1	UTSW	2	128,629,549 (GRCm38)	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128,659,917 (GRCm38)	missense	probably benign
R5271:Anapc1	UTSW	2	128,685,985 (GRCm38)	nonsense	probably null
R5363:Anapc1	UTSW	2	128,650,194 (GRCm38)	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128,675,701 (GRCm38)	nonsense	probably null
R5473:Anapc1	UTSW	2	128,607,195 (GRCm38)	unclassified	probably benign
R5559:Anapc1	UTSW	2	128,680,434 (GRCm38)	nonsense	probably null
R5631:Anapc1	UTSW	2	128,657,217 (GRCm38)	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128,624,916 (GRCm38)	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128,607,037 (GRCm38)	unclassified	probably benign
R6226:Anapc1	UTSW	2	128,650,372 (GRCm38)	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128,672,135 (GRCm38)	nonsense	probably null
R6561:Anapc1	UTSW	2	128,663,999 (GRCm38)	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128,684,534 (GRCm38)	nonsense	probably null
R6799:Anapc1	UTSW	2	128,659,737 (GRCm38)	missense	probably null	0.38
R6978:Anapc1	UTSW	2	128,669,900 (GRCm38)	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128,648,681 (GRCm38)	splice site	probably null
R7041:Anapc1	UTSW	2	128,628,656 (GRCm38)	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128,615,430 (GRCm38)	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128,678,274 (GRCm38)	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128,674,602 (GRCm38)	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128,613,010 (GRCm38)	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128,674,684 (GRCm38)	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128,641,537 (GRCm38)	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128,684,608 (GRCm38)	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128,669,908 (GRCm38)	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128,674,593 (GRCm38)	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128,648,488 (GRCm38)	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128,632,627 (GRCm38)	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128,619,917 (GRCm38)	nonsense	probably null
R8402:Anapc1	UTSW	2	128,630,228 (GRCm38)	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128,675,837 (GRCm38)	missense	probably benign
R8425:Anapc1	UTSW	2	128,669,868 (GRCm38)	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128,658,344 (GRCm38)	splice site	probably null
R8553:Anapc1	UTSW	2	128,619,913 (GRCm38)	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128,685,828 (GRCm38)	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128,641,453 (GRCm38)	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128,641,449 (GRCm38)	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128,657,173 (GRCm38)	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128,657,173 (GRCm38)	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128,622,413 (GRCm38)	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128,664,032 (GRCm38)	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128,641,402 (GRCm38)	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128,634,708 (GRCm38)	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128,622,506 (GRCm38)	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128,623,502 (GRCm38)	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128,622,500 (GRCm38)	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128,617,722 (GRCm38)	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128,634,678 (GRCm38)	missense	probably benign
R9436:Anapc1	UTSW	2	128,676,125 (GRCm38)	missense	probably benign
R9516:Anapc1	UTSW	2	128,675,713 (GRCm38)	missense	possibly damaging	0.77
R9563:Anapc1	UTSW	2	128,664,060 (GRCm38)	nonsense	probably null
R9572:Anapc1	UTSW	2	128,664,056 (GRCm38)	missense	probably benign
R9757:Anapc1	UTSW	2	128,675,756 (GRCm38)	missense	probably damaging	1.00
R9766:Anapc1	UTSW	2	128,658,301 (GRCm38)	missense	probably damaging	1.00
X0066:Anapc1	UTSW	2	128,674,701 (GRCm38)	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GGCGCACACATATCCAGTATC -3'
(R):5'- ACTCAGAGTACCATCGCAATG -3'

Sequencing Primer
(F):5'- CAACAGTTTTATGTTTGCAGGC -3'
(R):5'- GAGTACCATCGCAATGTTGAGTCTC -3'

Posted On

2018-10-18