Incidental Mutation 'R6887:Raly'
List |< first << previous [record 28 of 40] next >> last >|
ID536981
Institutional Source Beutler Lab
Gene Symbol Raly
Ensembl Gene ENSMUSG00000027593
Gene NamehnRNP-associated with lethal yellow
SynonymsMerc
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location154791096-154867261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 154861910 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 134 (V134F)
Ref Sequence ENSEMBL: ENSMUSP00000114185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029120] [ENSMUST00000058089] [ENSMUST00000109701] [ENSMUST00000116389] [ENSMUST00000125872] [ENSMUST00000129137] [ENSMUST00000137333] [ENSMUST00000140713]
Predicted Effect probably damaging
Transcript: ENSMUST00000029120
AA Change: V150F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029120
Gene: ENSMUSG00000027593
AA Change: V150F

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 109 123 N/A INTRINSIC
low complexity region 133 160 N/A INTRINSIC
low complexity region 227 259 N/A INTRINSIC
low complexity region 287 301 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058089
AA Change: V134F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058105
Gene: ENSMUSG00000027593
AA Change: V134F

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 117 144 N/A INTRINSIC
low complexity region 211 243 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109701
AA Change: V134F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105323
Gene: ENSMUSG00000027593
AA Change: V134F

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 117 144 N/A INTRINSIC
low complexity region 211 243 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116389
AA Change: V150F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112090
Gene: ENSMUSG00000027593
AA Change: V150F

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 109 123 N/A INTRINSIC
low complexity region 133 160 N/A INTRINSIC
low complexity region 227 259 N/A INTRINSIC
low complexity region 287 301 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125872
AA Change: V134F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119108
Gene: ENSMUSG00000027593
AA Change: V134F

DomainStartEndE-ValueType
RRM 22 88 1.6e-16 SMART
low complexity region 120 140 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129137
AA Change: V134F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114185
Gene: ENSMUSG00000027593
AA Change: V134F

DomainStartEndE-ValueType
RRM 22 88 1.6e-16 SMART
low complexity region 117 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137333
SMART Domains Protein: ENSMUSP00000122261
Gene: ENSMUSG00000027596

DomainStartEndE-ValueType
Agouti 6 70 2.53e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140713
AA Change: V150F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119126
Gene: ENSMUSG00000027593
AA Change: V150F

DomainStartEndE-ValueType
RRM 22 88 4.01e-14 SMART
low complexity region 109 123 N/A INTRINSIC
low complexity region 133 160 N/A INTRINSIC
low complexity region 227 259 N/A INTRINSIC
Meta Mutation Damage Score 0.2511 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heterogeneous nuclear ribonucleoprotein (hnRNP) gene family. This protein may play a role in pre-mRNA splicing and in embryonic development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trap allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Raly
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01838:Raly APN 2 154859670 splice site probably benign
IGL02164:Raly APN 2 154859929 nonsense probably null
R0227:Raly UTSW 2 154865921 missense probably damaging 0.98
R1412:Raly UTSW 2 154857395 missense possibly damaging 0.95
R1416:Raly UTSW 2 154857353 nonsense probably null
R2247:Raly UTSW 2 154864033 missense possibly damaging 0.92
R4110:Raly UTSW 2 154857458 nonsense probably null
R4533:Raly UTSW 2 154865933 missense probably damaging 0.98
R4654:Raly UTSW 2 154857456 missense probably damaging 1.00
R4866:Raly UTSW 2 154861896 missense probably damaging 0.99
R5395:Raly UTSW 2 154864007 unclassified probably null
R6254:Raly UTSW 2 154857366 missense probably damaging 1.00
R7069:Raly UTSW 2 154859744 missense possibly damaging 0.93
R7117:Raly UTSW 2 154857512 missense probably benign 0.35
R7289:Raly UTSW 2 154861854 missense probably damaging 1.00
R7311:Raly UTSW 2 154857420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCACACCAGGGCTTCTTGG -3'
(R):5'- TCTAGCTTAGGGGTTCTCGAC -3'

Sequencing Primer
(F):5'- ACACCAGGGCTTCTTGGAAGAC -3'
(R):5'- ACTCCTGATGCTGCAAGTGAC -3'
Posted On2018-10-18