Incidental Mutation 'R6887:Exosc8'
ID536982
Institutional Source Beutler Lab
Gene Symbol Exosc8
Ensembl Gene ENSMUSG00000027752
Gene Nameexosome component 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location54728678-54735393 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54733699 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 39 (V39M)
Ref Sequence ENSEMBL: ENSMUSP00000115876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029315] [ENSMUST00000029316] [ENSMUST00000044567] [ENSMUST00000141191] [ENSMUST00000153224] [ENSMUST00000154787] [ENSMUST00000155273] [ENSMUST00000199674] [ENSMUST00000200439] [ENSMUST00000200441]
Predicted Effect probably benign
Transcript: ENSMUST00000029315
SMART Domains Protein: ENSMUSP00000029315
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 107 159 N/A INTRINSIC
coiled coil region 201 230 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000029316
AA Change: V51M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029316
Gene: ENSMUSG00000027752
AA Change: V51M

DomainStartEndE-ValueType
Pfam:RNase_PH 31 166 2.3e-29 PFAM
Pfam:RNase_PH_C 191 258 8.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044567
SMART Domains Protein: ENSMUSP00000035879
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 63 174 2.1e-10 PFAM
Pfam:Glycos_transf_2 68 250 2.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141191
SMART Domains Protein: ENSMUSP00000118818
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153224
AA Change: V51M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118780
Gene: ENSMUSG00000027752
AA Change: V51M

DomainStartEndE-ValueType
Pfam:RNase_PH 31 130 2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154787
AA Change: V39M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115876
Gene: ENSMUSG00000027752
AA Change: V39M

DomainStartEndE-ValueType
Pfam:RNase_PH 19 106 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155273
SMART Domains Protein: ENSMUSP00000119260
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199674
SMART Domains Protein: ENSMUSP00000142948
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 3.3e-39 PFAM
low complexity region 424 442 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200439
SMART Domains Protein: ENSMUSP00000143059
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 2.7e-42 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200441
SMART Domains Protein: ENSMUSP00000143231
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 123 171 N/A INTRINSIC
coiled coil region 213 242 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 3'-5' exoribonuclease that specifically interacts with mRNAs containing AU-rich elements. The encoded protein is part of the exosome complex that is important for the degradation of numerous RNA species. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Exosc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Exosc8 APN 3 54729265 missense probably damaging 0.97
IGL03348:Exosc8 APN 3 54732722 missense possibly damaging 0.91
R1037:Exosc8 UTSW 3 54732738 missense probably damaging 0.98
R1233:Exosc8 UTSW 3 54731998 missense probably benign 0.30
R1623:Exosc8 UTSW 3 54734331 missense probably damaging 0.99
R1647:Exosc8 UTSW 3 54734101 critical splice donor site probably null
R1928:Exosc8 UTSW 3 54728845 missense probably damaging 1.00
R3005:Exosc8 UTSW 3 54732147 synonymous probably null
R4851:Exosc8 UTSW 3 54732102 unclassified probably benign
R4932:Exosc8 UTSW 3 54729290 missense possibly damaging 0.81
R5010:Exosc8 UTSW 3 54729223 missense probably benign 0.00
R5506:Exosc8 UTSW 3 54731179 unclassified probably benign
R5860:Exosc8 UTSW 3 54735042 unclassified probably benign
R7543:Exosc8 UTSW 3 54729248 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CACCTTGTAAAGCGTTAATGATGC -3'
(R):5'- AAGTCACTGACCTGAACCG -3'

Sequencing Primer
(F):5'- ACCTCATAAGCATGCAGT -3'
(R):5'- TGACCTGAACCGGTCAAAAGTTTC -3'
Posted On2018-10-18