Incidental Mutation 'R6887:Vmn2r7'
List |< first << previous [record 38 of 40] next >> last >|
ID536983
Institutional Source Beutler Lab
Gene Symbol Vmn2r7
Ensembl Gene ENSMUSG00000116028
Gene Name
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6887 (G1)
Quality Score213.009
Status Validated
Chromosome3
Chromosomal Location64690660-64719602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64690827 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 770 (C770S)
Ref Sequence ENSEMBL: ENSMUSP00000131220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161972] [ENSMUST00000168072]
Predicted Effect probably damaging
Transcript: ENSMUST00000161972
AA Change: C861S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124192
Gene: ENSMUSG00000062200
AA Change: C861S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 90 507 3.8e-77 PFAM
Pfam:NCD3G 549 602 3.4e-17 PFAM
Pfam:7tm_3 635 869 1.1e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168072
AA Change: C770S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131220
Gene: ENSMUSG00000116028
AA Change: C770S

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 5.1e-72 PFAM
Pfam:Peripla_BP_6 63 245 6.1e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 4.3e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Vmn2r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Vmn2r7 APN 3 64715813 missense possibly damaging 0.60
IGL01762:Vmn2r7 APN 3 64691435 missense probably benign 0.39
IGL01903:Vmn2r7 APN 3 64719443 missense probably benign 0.00
IGL02263:Vmn2r7 APN 3 64691447 missense probably damaging 1.00
IGL02458:Vmn2r7 APN 3 64693025 missense probably damaging 0.97
IGL02593:Vmn2r7 APN 3 64693022 missense probably damaging 1.00
IGL02797:Vmn2r7 APN 3 64691245 missense possibly damaging 0.80
IGL03047:Vmn2r7 UTSW 3 64707218 missense possibly damaging 0.81
PIT4504001:Vmn2r7 UTSW 3 64715976 missense probably benign 0.01
R0193:Vmn2r7 UTSW 3 64691039 missense probably damaging 1.00
R0329:Vmn2r7 UTSW 3 64691018 missense probably damaging 1.00
R0609:Vmn2r7 UTSW 3 64716479 missense probably benign 0.44
R0735:Vmn2r7 UTSW 3 64716367 missense probably benign 0.02
R0941:Vmn2r7 UTSW 3 64716579 missense probably benign
R1065:Vmn2r7 UTSW 3 64707138 missense possibly damaging 0.82
R1378:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R1445:Vmn2r7 UTSW 3 64724802 missense probably benign 0.01
R1506:Vmn2r7 UTSW 3 64707079 missense probably benign
R1509:Vmn2r7 UTSW 3 64716460 nonsense probably null
R1519:Vmn2r7 UTSW 3 64716455 missense possibly damaging 0.95
R1706:Vmn2r7 UTSW 3 64691459 missense possibly damaging 0.79
R2113:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R3725:Vmn2r7 UTSW 3 64724991 missense possibly damaging 0.65
R3874:Vmn2r7 UTSW 3 64719611 missense possibly damaging 0.69
R3902:Vmn2r7 UTSW 3 64719516 missense possibly damaging 0.46
R4084:Vmn2r7 UTSW 3 64692993 missense probably benign 0.08
R4117:Vmn2r7 UTSW 3 64715717 intron probably benign
R4333:Vmn2r7 UTSW 3 64690778 missense probably damaging 1.00
R4551:Vmn2r7 UTSW 3 64690689 missense possibly damaging 0.86
R4643:Vmn2r7 UTSW 3 64716404 missense probably damaging 1.00
R4654:Vmn2r7 UTSW 3 64719443 missense probably benign 0.00
R5091:Vmn2r7 UTSW 3 64690784 missense possibly damaging 0.63
R5109:Vmn2r7 UTSW 3 64690667 missense probably null 0.84
R5372:Vmn2r7 UTSW 3 64716324 missense probably damaging 1.00
R5415:Vmn2r7 UTSW 3 64716237 missense probably benign 0.07
R5740:Vmn2r7 UTSW 3 64707233 missense probably benign
R5977:Vmn2r7 UTSW 3 64716043 nonsense probably null
R6019:Vmn2r7 UTSW 3 64716222 missense probably damaging 1.00
R6058:Vmn2r7 UTSW 3 64725015 missense probably benign 0.00
R6139:Vmn2r7 UTSW 3 64715918 missense probably damaging 1.00
R6696:Vmn2r7 UTSW 3 64707074 missense probably benign 0.01
R6918:Vmn2r7 UTSW 3 64691339 missense probably benign 0.03
R6949:Vmn2r7 UTSW 3 64691121 missense probably damaging 0.99
R6980:Vmn2r7 UTSW 3 64716566 missense possibly damaging 0.67
R7196:Vmn2r7 UTSW 3 64715777 missense probably benign 0.00
R7286:Vmn2r7 UTSW 3 64690880 missense probably benign 0.00
R7455:Vmn2r7 UTSW 3 64716593 missense probably benign
R7557:Vmn2r7 UTSW 3 64724973 missense probably benign
R7864:Vmn2r7 UTSW 3 64691526 missense probably benign 0.10
R8046:Vmn2r7 UTSW 3 64707058 missense probably damaging 1.00
R8068:Vmn2r7 UTSW 3 64716086 missense probably benign 0.01
R8252:Vmn2r7 UTSW 3 64693106 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGCTTTGCATGTCACATG -3'
(R):5'- AGCCTCCAAGCCTGTTCAAG -3'

Sequencing Primer
(F):5'- GCATGTCACATGGATCTCACTG -3'
(R):5'- AAGGTTCTATAGAGTTTCTGTGCTCC -3'
Posted On2018-10-18